Number Name Hyperlinks Gal-Cln3 Gal-Cln3 Gal-Clb2 Gal-Clb2 Promoter Elements Process Function Peak Phase Order Cluster Order ORF YPD SGD YPD SGD MIPS #1 #2 Geomean Absolute #1 #2 Geomean Absolute Deletion Known? Description Aggregate Score Phase No. Elements Most Relevant Promoter Elements Number SCB SCB SCB SCB Number SCB_d SCB_d SCB_d SCB_d Number MCB MCB MCB MCB Number MCB_d MCB_d MCB_d MCB_d Number SFF Number Swi5 Swi5 Swi5 Swi5 Number Swi5e Swi5e Swi5e Swi5e Number ECB Number STE12 MIG1 sites unknown unknown G2/M 778 205 YAL022C YAL022C FUN26 YPD SGD MIPS 1.46 1.16 1.30 0.77 1.42 1.85 1.14 1.14 viable New "weak similarity to Na+/H+ antiporter, has 11 potential transmembrane domains " 3.795 0.843 cell cycle G1/S cyclin G2/M 747 256 YAL040C CLN3 CLN3 YPD SGD MIPS 7.55 10.78 9.02 9.02 1.03 1.65 1.26 1.26 viable Known "G1/S-specific cyclin, interacts with Cdc28p protein kinase to control events at START " 2.422 1.249 4 w 542 acgCGCGAAAaag c 566 ttcCGCGAAAaaa w 545 gcaACGCGcgaaa c 475 aaaACGCGgttgg 2 w 542 acgCGCGAAAaag c 566 ttcCGCGAAAaaa 2 w 545 gcaACGCGcgaaa c 475 aaaACGCGgttgg 1 w 225 GAAGCCAGCCAG unknown unknown G1 331 432 YAL053W YAL053W YAL053W YPD SGD MIPS 2.41 1.27 1.75 1.75 1.72 1.89 1.80 0.56 undocumented New Protein of unknown function 1.580 -1.591 1 c254 tcgCGCGAAAaaa 1 c254 tcgCGCGAAAaaa drug resistance suppressor of sulfoxyde ethionine S 445 629 YAL067C SEO1 SEO1 YPD SGD MIPS 1.47 1.11 1.28 0.78 2.19 1.05 1.44 0.69 undocumented New Protein with similarity to Dal5p and members of the allantoate permease family of the major facilitator superfamily (MFS) 1.648 -2.587 unknown unknown G1 212 464 YAR003W YAR003W YAR003W YPD SGD MIPS 2.12 1.33 1.68 1.68 1.28 1.22 1.25 0.80 undocumented New contains WD40 repeat; similarity to human RB protein binding protein 2.121 -1.099 1 w 170 attACGCGattcg 1 w 170 attACGCGattcg 4 w 635 TCAACCAGCCAC w 478 CGCACCAGCGTC c 19 AGAACCAGCTGA c 336 TTTACCAGCTCA DNA replication "replication factor A, 69 kD subunit" G1 262 527 YAR007C RFA1 RFA1 YPD SGD MIPS 1.94 1.71 1.82 1.82 2.57 1.33 1.85 0.54 lethal Known DNA replication Factor A; promoter has Mlu1 cell cycle box (MCB) elements 8.339 -1.305 5 c118 tcaCGCGAAAaat c326 cctCGCGAAAgaa w410 caaACGCGTgtt w128 gtgACGCGTtat c 117 gtcACGCGaaaaa 2 c118 tcaCGCGAAAaat c326 cctCGCGAAAgaa 2 w410 caaACGCGTgtt w128 gtgACGCGTtat 1 c 117 gtcACGCGaaaaa tRNA splicing splicing endonuclease subunit G1 215 417 YAR008W SEN34 SEN34 YPD SGD MIPS 1.64 1.04 1.26 0.80 1.78 1.33 1.54 0.65 lethal New "tRNA splicing endonuclease, gamma subunit, has active site for 3' slice site cleavage " 3.660 -1.113 5 w219 ttcACGCGTctt w189 tttACGCGTgac w 675 agcACGCGactgg w 593 atcACGCGaatga w 59 ggtACGCGcatag 2 w219 ttcACGCGTctt w189 tttACGCGTgac 3 w 675 agcACGCGactgg w 593 atcACGCGaatga w 59 ggtACGCGcatag 1 c 321 GAAACCAGCAAG 1 c 321 GAAACCAGCAAG 1 unknown protein kinase G2/M 767 88 YAR018C KIN3 KIN3 YPD SGD MIPS 1.30 1.19 1.25 0.80 3.39 3.52 3.45 3.45 viable Known similar to Pho85; null has no phenotype 6.090 0.995 1 w 487 AATACCAGCAAA phosphate metabolism secreted acid phosphatase G2/M 780 94 YAR071W PHO11 PHO11 YPD SGD MIPS 1.48 1.82 1.64 0.61 12.87 6.90 9.42 9.42 viable New acid phosphatase 8.047 0.813 w 427 AGAAAAGCGGGG chromatin structure histone H2B S 424 789 YBL002W HTB2 HTB2 YPD SGD MIPS 3.46 2.57 2.99 2.99 1.73 1.46 1.59 0.63 viable Known Histone H2B (HTB1 and HTB2 code for nearly identical proteins) 8.477 -2.428 2 w543 gaaCGCGAAAaca w 544 agaACGCGaaaac 1 w543 gaaCGCGAAAaca 1 w 544 agaACGCGaaaac 4 w 567 CTCACCAGCAAC w 490 CTGGCCAGCTAG c 320 ACCACCAGCTTA c 494 CTGGCCAGCAAG 1 c 494 CTGGCCAGCAAG chromatin structure histone H2A S 441 790 YBL003C HTA2 HTA2 YPD SGD MIPS 3.50 2.35 2.87 2.87 1.46 1.10 1.27 0.79 viable Known Histone H2A (HTA1 and HTA2 code for identical proteins) 10.320 -2.579 3 w 366 cttACGCGTgag c 240 attACGCGatgtt c 439 taaACGCGacgtg 1 w 366 cttACGCGTgag 2 c 240 attACGCGatgtt c 439 taaACGCGacgtg unknown unknown G1 401 738 YBL009W YBL009W YBL009W YPD SGD MIPS 1.91 1.47 1.68 1.68 1.42 1.30 1.04 0.96 undocumented New similar to ALK1 2.060 -2.228 1 w144 attCGCGAAActt 1 w144 attCGCGAAActt DNA replication MCM initiator complex G2/M 790 97 YBL023C MCM2 MCM2 YPD SGD MIPS 1.11 1.22 1.16 1.16 1.37 2.26 1.76 1.76 lethal New Member of the MCM/P1 family that acts as a complex at ARS's to initiate replication 4.274 0.688 1 c 215 tacACGCGattcc transport mitochondrial ADP/ATP translocator G2/M 703 151 YBL030C PET9 PET9 YPD SGD MIPS 1.06 1.05 1.05 1.05 1.39 1.04 1.15 0.87 viable New ADP/ATP carrier protein of the mitochondrial carrier (MCF) family 1.391 1.611 DNA replication "DNA polymerase alpha, 70 kD subunit" G1 216 494 YBL035C POL12 POL12 YPD SGD MIPS 1.18 1.37 1.27 1.27 1.77 1.09 1.39 0.72 lethal Known "DNA polymerase alpha 86 kDa subunit, B subunit of polymerase alpha-primase complex; promoter has Mlu1 cell cycle box (MCB) elements" 6.918 -1.123 2 w609 gagACGCGTtca c 560 ctaACGCGgtgcg 1 w609 gagACGCGTtca 1 c 560 ctaACGCGgtgcg silencing unknown S/G2 565 677 YBL052C SAS3 SAS3 YPD SGD MIPS 1.01 1.27 1.12 1.12 1.76 1.05 1.30 0.77 viable New Protein that influences silencing at HMR 1.936 2.674 cell wall biogenesis chitin synthase regulator M/G1 104 293 YBL061C SKT5 SKT5 YPD SGD MIPS 1.60 1.06 1.23 1.23 1.65 1.15 1.38 0.73 viable New "Protoplast regeneration and killer toxin resistance protein, required for chitin synthase III activity " 2.287 -0.480 1 c 197 aaaACGCGaagtg "mitosis, spindle assembly" kinesin related protein S 467 731 YBL063W KIP1 KIP1 YPD SGD MIPS 1.90 1.40 1.63 1.63 1.63 1.09 1.33 0.75 viable New Kinesin-related protein involved in establishment and maintenance of mitotic spindle 2.574 -2.836 unknown similar to Tsa1p M/G1 93 321 YBL064C YBL064C YBL064C YPD SGD MIPS 1.59 1.92 1.75 0.57 1.16 1.17 1.00 1.00 viable New Protein with similarity to Tsa1p 1.895 -0.347 unknown similar to bacterial NADP/NAD-dependent G2/M 706 197 YBL098W YBL098W YBL098W YPD SGD MIPS 1.58 1.32 1.44 0.69 1.11 1.03 1.07 0.94 undocumented New "Protein with similarity to bacterial NADP/NAD-dependent oxidoreductases involved in metabolism of aromatic compounds; member of unknown family 1 of proteins of unknown function, a subfamily of the major facilitator superfamily (MFS), which includes Ybl098p, Yel064p, Yer119p, Yil088p, Yjr001p, Ykl146p, and Ynl101p." 2.044 1.601 unknown unknown G2/M 711 152 YBL100C YBL100C YBL100C YPD SGD MIPS 1.13 1.12 1.13 0.89 1.15 1.01 1.08 0.93 undocumented New Protein of unknown function 1.486 1.571 unknown unknown G1 123 583 YBL111C YBL111C YBL111C SGD MIPS 1.30 2.06 1.26 1.26 1.16 1.36 1.08 1.08 undocumented New Protein with similarity to other subtelomerically-encoded proteins 3.980 -0.571 1 w 573 ctgACGCGccata 1 w 573 ctgACGCGccata unknown unknown G1 137 590 YBL112C YBL112C SGD MIPS 2.01 2.74 2.35 2.35 1.20 1.04 1.07 0.93 undocumented New Protein with similarity to other subtelomerically-encoded proteins 3.112 -0.646 unknown unknown G1 127 582 YBL113C YBL113C YBL113C SGD MIPS 1.32 1.41 1.03 1.03 1.39 1.48 1.03 1.03 undocumented New Y' short ORF no intron 3.692 -0.596 1 w 14 ggtACGCGagttc 1 w 14 ggtACGCGagttc w 296 TATTCGGCGGGG unknown unknown G1 351 434 YBR007C YBR007C YBR007C YPD SGD MIPS 2.18 1.18 1.60 1.60 1.64 1.75 1.70 0.59 undocumented New novel 1.383 -1.701 3 w14 tcaCACGAAAagt w428 tgaACGCGTctc c 310 ttaACGCGcagaa 1 w14 tcaCACGAAAagt 1 w428 tgaACGCGTctc 1 c 310 ttaACGCGcagaa 1 w 503 AATACCAGCCAG fluconazole resistance "transporter, major facilitator superfamily" S 473 704 YBR008C FLR1 FLR1 YPD SGD MIPS 1.65 1.82 1.05 0.95 1.05 1.04 1.05 0.96 viable New Protein with similarity to members of the major facilitator superfamily (MFS) multidrug-resistance proteins family 2.806 -2.897 2 c 676 acaCACGAAAatc c 453 tatACGCGgtagc 1 c 676 acaCACGAAAatc 1 c 453 tatACGCGgtagc chromatin structure histone H4 S 417 791 YBR009C HHF1 HHF1 YPD SGD MIPS 2.51 1.01 1.58 1.58 1.57 1.02 1.24 0.80 viable Known Histone H4 (HHF1 and HHF2 code for identical proteins) 7.635 -2.399 3 w 345 ctcACGCGTaag w 472 attACGCGatgtt w 273 taaACGCGacgtg 1 w 345 ctcACGCGTaag 2 w 472 attACGCGatgtt w 273 taaACGCGacgtg chromatin structure histone H3 S 420 795 YBR010W HHT1 HHT1 YPD SGD MIPS 2.49 1.87 2.16 2.16 2.04 1.26 1.27 0.79 viable Known Histone H3 (HHT1 and HHT2 code for identical proteins) 9.399 -2.413 cell wall biogenesis chitin synthase II G2/M 709 224 YBR038W CHS2 CHS2 YPD SGD MIPS 1.10 1.19 1.04 1.04 1.02 2.53 1.57 1.57 viable New Chitin synthase II 9.593 1.591 1 c 77 agtCACGAAAtca 1 c 563 gtaACGCGcttat 1 c 498 ATTGCCAGCCGC unknown similar to rat calcium-binding protein regucalcin M/G1 41 336 YBR053C YBR053C YBR053C YPD SGD MIPS 1.08 1.92 1.44 0.69 1.19 1.41 1.29 1.29 undocumented New Protein with similarity to rat calcium-binding protein regucalcin and rat senescence marker protein 30 1.362 0.099 unknown putative heat shock protein G2/M 785 91 YBR054W YRO2 YRO2 YPD SGD MIPS 4.06 5.88 4.88 0.20 3.74 10.44 6.25 6.25 undocumented Known "Protein with similarity to heat shock protein YDR033w and Hsp30p, has 7 potential transmembrane domains" 12.970 0.803 1 w 163 tttCACGAAAgtg 1 w 229 TTACCCAGAAAGGAAA stress response (putative) cell wall mannoprotein M/G1 90 320 YBR067C TIP1 TIP1 YPD SGD MIPS 5.43 4.35 4.86 0.21 2.16 2.02 2.09 2.09 viable Known "Cold- and heat-shock induced mannoprotein of the cell wall, member of the PAU1 family " 3.417 -0.327 2 w 613 GGGGCCAGCAAC w 613 GGGGCCAGCAAC 1 c 218 cagCGCGAAAagt 1 w 613 GGGGCCAGCAAC 1 w 613 GGGGCCAGCAAC transport amino acid permease G2/M 731 196 YBR069C VAP1 VAP1 YPD SGD MIPS 2.47 4.35 3.27 0.31 1.23 1.29 1.26 1.26 viable New "Amino acid permease for valine, leucine, isoleucine, tyrosine, and tryptophan " 1.812 1.412 stress response osmotolerance protein (putative) G1 237 490 YBR070C SAT2 YBR070C YPD SGD MIPS 2.29 1.78 2.02 2.02 3.02 1.37 2.04 0.49 lethal New Protein involved in osmotolerance 3.742 -1.215 5 c156 aaaCACGAAAtta w311 aagCGCGAAAtta w174 ctaCGCGAAAgtt w 200 attACGCGcatta w 175 cctACGCGaaagt 1 c156 aaaCACGAAAtta 2 w311 aagCGCGAAAtta w174 ctaCGCGAAAgtt 2 w 200 attACGCGcatta w 175 cctACGCGaaagt 1 unknown similar to Herpesvirus saimiri EERF2 G1 169 563 YBR071W YBR071W YBR071W YPD SGD MIPS 4.60 2.06 3.08 3.08 3.40 5.00 4.12 0.24 undocumented New Protein with weak similarity to Herpesvirus saimiri EERF2 6.969 -0.824 5 w333 aaaCACGAAAtta c178 aagCGCGAAAtta c315 ctaCGCGAAAgtt c 289 attACGCGcatta c 314 cctACGCGaaagt 1 w333 aaaCACGAAAtta 2 c178 aagCGCGAAAtta c315 ctaCGCGAAAgtt 2 c 289 attACGCGcatta c 314 cctACGCGaaagt meiosis helicase G1 282 469 YBR073W RDH54 RDH54 YPD SGD MIPS 2.88 1.61 2.15 2.15 2.13 2.56 2.34 0.43 viable New Protein required for mitotic diploid-specific recombination and repair and for meiosis 3.306 -1.386 3 w 199 acaACGCGctgtt w 74 aaaACGCGaagag c 112 ttaACGCGatcga 3 w 199 acaACGCGctgtt w 74 aaaACGCGaagag c 112 ttaACGCGatcga pseudohyphal growth trancriptional activator M/G1 53 275 YBR083W TEC1 TEC1 YPD SGD MIPS 1.39 1.82 1.59 0.63 1.30 1.29 1.29 1.29 viable Known Transcriptional activator involved with STE12 in pseudohyphal formation 4.634 -0.010 1 w 693 AAAGCCAGCTAT 1 w 629 ttcCACGAAAaca 1 c 439 cgtACGCGgaatg 1 w 693 AAAGCCAGCTAT unknown similar to calcium and sodium channel proteins G2/M 623 154 YBR086C YBR086C YBR086C YPD SGD MIPS 1.77 1.42 1.59 1.59 1.18 1.33 1.25 1.25 undocumented New "Protein with similarity to calcium and sodium channel proteins, has 7-9 potential transmembrane domains " 3.200 2.154 1 c 647 ttaACGCGatttt DNA replication DNA polymerase processivity factor G1 275 610 YBR087W RFC5 RFC5 YPD SGD MIPS 1.32 1.19 1.26 1.26 1.13 1.52 1.16 1.16 lethal New "Replication factor C, 40 kDa subunit " 1.481 -1.363 1 w 89 ttaACGCGatttt 1 w 89 ttaACGCGatttt DNA replication DNA polymerase processivity factor G1 252 538 YBR088C POL30 POL30 YPD SGD MIPS 5.33 4.15 4.70 4.70 3.72 2.70 3.17 0.32 lethal Known "Proliferating cell nuclear antigen (PCNA), required for DNA synthesis and DNA repair" 10.050 -1.268 4 w584 gtaCACGAAAttc w541 agtCACGAAAcgc w609 catCGCGAAAttt w 535 gaaACGCGccaaa 2 w584 gtaCACGAAAttc w541 agtCACGAAAcgc 1 w609 catCGCGAAAttt 1 w 535 gaaACGCGccaaa unknown unknown G1 293 495 YBR089W YBR089W YBR089W YPD SGD MIPS 1.77 2.01 1.07 1.07 1.50 1.02 1.21 0.83 undocumented New novel; questionable ORF 9.285 -1.427 thiamine uptake "acid phosphatase, constitutive" G2/M 755 202 YBR092C PHO3 PHO3 YPD SGD MIPS 1.22 3.23 1.98 0.50 1.39 18.18 3.61 3.61 undocumented New acid phosphatase 10.740 1.110 phosphate metabolism "acid phosphatase, repressible" G2/M 723 95 YBR093C PHO5 PHO5 YPD SGD MIPS 1.86 3.33 2.49 0.40 17.42 12.86 14.97 14.97 viable New acid phosphatase 3.862 1.453 1 w 148 CCCATTTGGGATAAGGGTAAACAT 1 w 148 CCCATTTGGGATAAGGGTAAACAT unknown similar to Mec1p and porcine tubulin-tyrosine G2/M 728 191 YBR094W YBR094W YBR094W YPD SGD MIPS 1.31 1.72 1.15 0.87 1.14 1.64 1.20 1.20 undocumented New Protein with weak similarity to Mec1p and porcine tubulin-tyrosine ligase 1.828 1.424 c 660 ATCTTTGTGGGG unknown "similar to wheat glutenin, secalin" G1 224 347 YBR108W YBR108W YBR108W YPD SGD MIPS 1.53 1.23 1.11 0.90 2.01 1.11 1.35 0.74 undocumented New "Protein with weak similarity to wheat glutenin, secalin, and Drosophila mastermind protein " 2.777 -1.160 1 c 678 GACGCCAGCATT cell cycle Swe1p (kinase) regulator S/G2 573 693 YBR133C HSL7 HSL7 YPD SGD MIPS 1.22 1.35 1.28 1.28 1.01 1.15 1.08 0.93 viable New Negative regulator of the Swe1p protein kinase 1.371 2.561 2 w 631 aacACGCGTgct w 523 ccaACGCGgccag 1 w 631 aacACGCGTgct 1 w 523 ccaACGCGgccag 1 w 518 GCGGCCAGCAGT 1 w 518 GCGGCCAGCAGT meiosis unknown G2/M 669 246 YBR138C HDR1 HDR1 YPD SGD MIPS 1.49 1.37 1.43 0.70 1.40 2.78 1.41 1.41 viable New Protein involved in meiotic segregation 3.004 1.845 1 w 357 aagCACGAAAact unknown similar to serine-type carboxypeptidases G2/M 690 181 YBR139W YBR139W YBR139W YPD SGD MIPS 1.15 1.67 1.38 0.72 1.11 1.43 1.26 1.26 undocumented New Protein with similarity to serine-type carboxypeptidases 1.722 1.691 1 c 411 AATACCAGCTCA w 163 CTTTTAGCGGGG unknown unknown M/G1 18 319 YBR157C YBR157C YBR157C YPD SGD MIPS 1.57 1.18 1.36 0.74 1.05 1.48 1.25 1.25 viable New Protein of unknown function 5.145 0.316 unknown required for optimal growth M/G1 85 291 YBR158W YBR158W YBR158W YPD SGD MIPS 1.28 1.69 1.15 0.87 1.61 1.47 1.54 1.54 viable New leucine repeat motif has similarity to that of Grr1p; null mutant cells have slow growth and reduced germination rate 7.599 -0.264 1 C 470 AACACCAGCAGG 1 C 470 AACACCAGCAGG unknown "similar to Sur1p, Hoc1p, and Och1p" G1 368 433 YBR161W YBR161W YBR161W YPD SGD MIPS 2.32 1.69 1.98 1.98 1.38 1.49 1.44 0.70 viable New "Protein with similarity to Sur1p, Hoc1p, and Och1p " 1.851 -1.845 2 w504 ataCGCGAAAgta w 505 tatACGCGaaagt 1 w504 ataCGCGAAAgta 1 w 505 tatACGCGaaagt bud emergence binds Cdc24p G2/M 782 80 YBR200W BEM1 BEM1 YPD SGD MIPS 1.69 2.08 1.88 0.53 1.01 1.56 1.25 1.25 viable New "Protein with SH3 domains, required for cell polarization and bud formation " 3.349 0.812 DNA replication MCM initiator complex G2/M 784 90 YBR202W CDC47 CDC47 YPD SGD MIPS 2.36 1.85 2.09 0.48 1.92 2.44 2.16 2.16 lethal Known MCM7; MCM proteins are components of the prereplication complex because association of MCM proteins with replication origins requires both Orc1p and Cdc6 function 9.591 0.811 1 w 135 CCTAATTAGGTTAAACGTAAATAA 1 w 135 CCTAATTAGGTTAAACGTAAATAA unknown similar to peroxisomal serine-active lipase M/G1 105 328 YBR204C YBR204C YBR204C YPD SGD MIPS 1.49 1.07 1.26 1.26 1.29 1.06 1.10 0.91 undocumented New Protein with similarity to peroxisomal serine-active lipase 1.630 -0.480 1 w 134 aggACGCGccatt unknown unknown G2/M 613 138 YBR242W YBR242W YBR242W YPD SGD MIPS 1.31 1.17 1.24 1.24 1.37 1.35 1.36 0.73 undocumented New strong similarity to hypothetical protein YGL101w 1.936 2.269 1 c 663 tccCGCGAAAcaa 1 c 410 gatACGCGgtctg protein glycosylation UDP-N-acetyl-glucosamine-1-P transferase (GPT) S/G2 502 718 YBR243C ALG7 ALG7 YPD SGD MIPS 2.79 2.27 2.51 2.51 1.89 1.12 1.30 0.77 lethal New involved in first step in the dolichol pathway of N-glycosylation of proteins 2.430 -3.132 1 w 106 cagCGCGAAAatt 1 w 106 cagCGCGAAAatt 1 c 584 TAAGCCAGCCTG flavin biosynthesis "riboflavin synthase, alpha chain" S/G2 513 314 YBR256C RIB5 RIB5 YPD SGD MIPS 1.16 1.82 1.25 0.80 1.18 1.12 1.15 0.87 viable New "Riboflavin synthase, last step of riboflavin synthesis, converts 6,7-dimethyl-8-ribityllumazine to riboflavin " 1.700 3.124 1 c 321 cctACGCGacaaa 1 c 321 cctACGCGacaaa unknown unknown M/G1 99 317 YBR273C YBR273C YBR273C YPD SGD MIPS 1.77 1.19 1.22 1.22 1.00 1.33 1.15 1.15 undocumented New Protein of unknown function 1.625 -0.413 unknown unknown G2/M 763 23 YBR287W YBR287W YBR287W YPD SGD MIPS 1.01 1.89 1.38 0.72 1.24 1.02 1.10 0.91 undocumented New similarity to hypothetical S. pombe protein 1.375 1.063 unknown similar to phosphate-repressible phosphate permease M/G1 29 380 YBR296C YBR296C YBR296C YPD SGD MIPS 1.61 1.01 1.26 0.79 1.09 1.09 1.00 1.00 undocumented New Protein with similarity to phosphate-repressible phosphate permease 1.800 0.231 unknown unknown G2/M 608 213 YCL012W YCL012W YCL012W YPD SGD MIPS 1.44 1.03 1.22 1.22 1.24 1.17 1.21 1.21 undocumented New Now considered part of Bud3 5.242 2.295 1 w 571 GCCGCCAGCTTC S/G2 587 215 YCL013W BUD3 BUD3 YPD SGD MIPS 1.54 1.10 1.30 1.30 1.20 2.14 1.60 1.60 viable New "This is now part of YCL014w, which is actually BUD3" 3.976 2.459 1 TCGAACAATTCTAAAAAGGTAAAT AAAAACAATGGTA 1 TCGAACAATTCTAAAAAGGTAAAT AAAAACAATGGTA 1 w 61 GCCGCCAGCTTC cell polarity bud site selection S/G2 595 214 YCL014W BUD3 BUD3 YPD SGD MIPS 1.57 1.40 1.48 1.48 1.39 1.36 1.38 1.38 viable New "Protein localized at the neck filament ring required for axial budding, may provide a memory of the previous bud site" 5.369 2.397 unknown unknown G1 194 496 YCL022C YCL022C YCL022C YPD SGD MIPS 1.52 1.57 1.55 1.55 1.05 1.13 1.09 1.09 undocumented New now considered part of YCL024W (KCC4) 7.009 -1.004 unknown unknown G1 207 401 YCL023C YCL023C YCL023C YPD SGD MIPS 1.52 1.45 1.02 0.98 1.03 1.20 1.11 0.90 undocumented New Protein of unknown function 3.792 -1.068 1 c 492 TTTGCCAGCGAC unknown protein kinase G1 200 497 YCL024W YCL024W YCL024W YPD SGD MIPS 1.78 1.83 1.80 1.80 1.39 1.05 1.15 0.87 undocumented New aka KCC4; close homologue of GIN4 8.194 -1.038 3 c190 gcaCGCGAAAaaa w169 aaaACGCGTaac c 189 agcACGCGaaaaa 1 c190 gcaCGCGAAAaaa 1 w169 aaaACGCGTaac 1 c 189 agcACGCGaaaaa transport amino acid permease S/G2 575 126 YCL025C AGP1 AGP1 YPD SGD MIPS 1.07 1.37 1.21 0.83 1.65 1.27 1.45 1.45 viable New Broad substrate range amino acid permease with high affinity for asparagine and glutamine 2.095 2.539 w 218 CCTAATTGGGTAAGTACATGATGAAACA mating; cell fusion SH3 domain protein M/G1 112 309 YCL027W FUS1 FUS1 YPD SGD MIPS 1.52 1.06 1.20 1.20 1.04 1.08 1.02 0.98 viable Known "Protein with SH3 domain required for cell fusion during mating, located at the tip of the mating projection (shmoo)" 1.710 -0.514 3 w 482 AAAACCAGCGTC w 482 AAAACCAGCGTC C 195 CGCACCAGCAAC 2 w 482 AAAACCAGCGTC C 195 CGCACCAGCAAC 1 w 482 AAAACCAGCGTC unknown unknown G2/M 725 195 YCL038C YCL038C YCL038C YPD SGD MIPS 1.93 1.89 1.91 0.52 1.28 1.80 1.52 1.52 undocumented New "Protein of unknown function, member of the major facilitator superfamily (MFS) " 1.541 1.439 glycolysis glucokinase M/G1 111 340 YCL040W GLK1 GLK1 YPD SGD MIPS 1.35 1.30 1.33 1.33 1.99 2.12 1.03 1.03 viable New "Glucokinase, specific for aldohexoses " 1.789 -0.513 1 w 634 GGCACCAGCAGA 1 w 529 tgcACGCGTaac 1 w 232 tagACGCGgcgct 1 w 634 GGCACCAGCAGA unknown unknown G1 177 339 YCL042W YCL042W YCL042W YPD SGD MIPS 1.05 1.49 1.19 1.19 1.65 1.42 1.08 0.93 undocumented New novel; questionable ORF 1.831 -0.895 1 w278 tgcACGCGTaac 1 w278 tgcACGCGTaac 1 w 383 GGCACCAGCAGA protein folding protein disulfide isomerase G2/M 708 158 YCL043C PDI1 PDI1 YPD SGD MIPS 2.46 1.02 1.55 1.55 1.15 1.15 1.15 0.87 lethal New Protein disulfide isomerase 1.407 1.601 1 w 96 gttACGCGTgca 1 c 394 tagACGCGgcgct karyogamy transcription factor M/G1 81 306 YCL055W KAR4 KAR4 YPD SGD MIPS 1.38 1.32 1.02 1.02 1.24 1.29 1.27 0.79 viable Known Regulatory protein required for pheromone induction of karyogamy genes 3.272 -0.253 G1 211 498 YCL060C YCL060C MIPS 1.85 2.10 1.97 1.97 1.91 1.28 1.57 0.64 irrelevant New now combined into YCL061C 6.432 -1.092 unknown unknown G1 238 442 YCL061C YCL061C YCL061C YPD SGD MIPS 1.36 1.60 1.48 1.48 1.34 1.40 1.37 0.73 undocumented New similarity to myosin heavy chain form b from Chicken and Xenopus 3.267 -1.218 S/G2 569 209 YCL062W YCL062W SGD MIPS 1.07 1.27 1.09 0.92 1.42 1.54 1.48 1.48 irrelevant New This is now part of YCL063w 1.980 2.599 1 c 365 GTGGCCAGCTCG unknown similar to plant aminocyclopropane-1-carboxylate S/G2 603 208 YCL063W YCL063W YCL063W YPD SGD MIPS 1.18 1.11 1.14 0.88 1.08 1.05 1.06 0.94 viable New Protein with similarity to plant aminocyclopropane-1-carboxylate synthase 3.017 2.311 1 w 132 actCGCGAAAaga 1 w 132 actCGCGAAAaga 1 c 403 TTAACCAGCGAG 1 c 403 TTAACCAGCGAG unknown unknown G2/M 762 46 YCL065W YCL065W YCL065W YPD SGD MIPS 1.83 1.63 1.73 0.58 1.28 1.25 1.01 0.99 undocumented New Protein of unknown function 2.192 1.072 1 w 588 CCCAATGTAGAAAAGTACATCATATGAAACA 1 w 102 ggcACGCGgacaa 1 transcription silenced copy at HML; see YCR040W G2/M 773 48 YCL066W ALPHA1 ALPHA1 YPD SGD MIPS 1.16 1.24 1.20 0.84 1.65 1.03 1.30 1.30 undocumented New "Regulatory protein MATalpha1p, with Mcm1p activates alpha-specific genes (ALPHA1 and MATALPHA1 have the same coding sequence, but ALPHA1 is silenced)" 1.442 0.942 1 w 119 CCCAATGTAGAAAAGTACATCATATGAAACA 1 S/G2 580 125 YCLX09W YCLX09W YCLX09W YPD SGD MIPS 1.40 1.27 1.34 0.75 1.12 1.19 1.15 1.15 undocumented New 1.557 2.488 cytokinesis septin S/G2 601 156 YCR002C CDC10 CDC10 YPD SGD MIPS 1.46 1.09 1.16 1.16 1.42 1.13 1.27 0.79 viable New "GTP-binding protein localized to the bud neck ring, involved in cytokinesis " 1.359 2.338 rRNA processing nucleolar protein M/G1 64 311 YCR018C SRD1 SRD1 YPD SGD MIPS 1.07 1.00 1.04 0.96 1.14 1.21 1.17 0.85 viable New "Nucleolar protein involved in pre-rRNA processing, does not bind to small nucleolar RNA (snoRNA) " 1.533 -0.120 1 w 321 TGTGCCAGCGGT 1 c 343 cgcCGCGAAAgca 1 w 321 TGTGCCAGCGGT H+ homeostasis regulates plasma membrane H+-ATPase G2/M 713 200 YCR024C-A PMP1 PMP1 YPD SGD MIPS 1.97 2.95 2.41 0.41 1.13 2.45 1.66 1.66 viable New "Plasma membrane proteolipid, associated with Pma1p and affects plasma membrane H-ATPase activity" 5.073 1.564 transcription alpha-specific gene activator G2/M 772 47 YCR040W ALPHA1 ALPHA1 YPD SGD MIPS 1.51 1.10 1.29 0.77 1.26 1.01 1.12 0.90 undocumented New "Regulatory protein MATalpha1p, with Mcm1p activates alpha-specific genes (ALPHA1 and MATALPHA1 have the same coding sequence, but ALPHA1 is silenced)" 2.374 0.949 1 w 119 CCCAATGTAGAAAAGTACATCATATGAAACA 1 unknown unknown G2/M 781 68 YCR041W YCR041W YCR041W YPD SGD MIPS 1.32 1.71 1.50 0.67 1.13 1.34 1.23 1.23 undocumented New Protein with unknown function 3.531 0.813 1 w 588 CCCAATGTAGAAAAGTACATCATATGAAACA 1 w 102 ggcACGCGgacaa 1 transcription TFIID associated factor (TAF) G2/M 777 78 YCR042C TSM1 TSM1 YPD SGD MIPS 1.62 1.28 1.44 0.69 1.32 1.90 1.59 1.59 lethal New Component of TAF(II) complex (TBP-associated protein complex); required for activated transcription by RNA polymerase II; required for G2/M phase progression 4.022 0.885 transcription (putative) forkhead family of DNA-binding proteins G1 260 475 YCR065W HCM1 HCM1 YPD SGD MIPS 3.30 2.27 2.74 2.74 1.51 1.49 1.50 0.67 viable New Dosage-dependent suppressor of cmd1 and member of the forkhead family of DNA-binding proteins 4.464 -1.299 7 w401 gaaCGCGAAAaaa w369 cgaCGCGAAAaaa w320 ataACGCGTtaa w272 aaaACGCGTcct w 402 ggaACGCGaaaaa w 383 cagACGCGagaac w 370 gcgACGCGaaaaa 2 w401 gaaCGCGAAAaaa w369 cgaCGCGAAAaaa 2 w320 ataACGCGTtaa w272 aaaACGCGTcct 3 w 402 ggaACGCGaaaaa w 383 cagACGCGagaac w 370 gcgACGCGaaaaa protein folding peptidyl-prolyl cis-trans isomerase S/G2 551 245 YCR069W SCC3 SCC3 YPD SGD MIPS 1.79 1.11 1.27 1.27 1.39 1.11 1.24 0.80 viable New "Cyclophilin (peptidylprolyl isomerase) of the endoplasmic reticulum membrane, homolog of ninaA " 1.628 2.872 1 c 618 ggcACGCGgtttc 1 c 618 ggcACGCGgtttc G2/M 691 107 YCRX05W 2.18 1.02 1.46 0.68 1.15 1.53 1.33 1.33 irrelevant New ? 1.660 1.691 1 w 538 ATAACCAGCAAT 1 w 538 ATAACCAGCAAT "mitosis, sister chromatid cohesion" unknown G1 255 539 YDL003W MCD1 MCD1 YPD SGD MIPS 18.55 5.88 10.44 10.44 3.15 2.50 2.81 0.36 lethal Known "aka RHC21; Cohesin, protein required for mitotic chromatid cohesion" 9.610 -1.273 3 w204 aaaCGCGAAAcgc w198 gaaACGCGTaac w 205 aaaACGCGaaacg 1 w204 aaaCGCGAAAcgc 1 w198 gaaACGCGTaac 1 w 205 aaaACGCGaaacg unknown similar to Ybr014p and glutaredoxins G1 214 508 YDL010W YDL010W YDL010W YPD SGD MIPS 2.36 1.14 1.64 1.64 1.50 1.56 1.53 0.65 undocumented New Protein with similarity to Ybr014p and glutaredoxins 1.526 -1.111 4 w136 gttCGCGAAAtcg w167 atgACGCGTccc w 176 ggaACGCGcatga c 462 taaACGCGgatga 1 w136 gttCGCGAAAtcg 1 w167 atgACGCGTccc 2 w 176 ggaACGCGcatga c 462 taaACGCGgatga unknown unknown G1 242 507 YDL011C YDL011C YDL011C YPD SGD MIPS 1.61 1.04 1.29 1.29 1.60 1.92 1.75 0.57 undocumented New novel; questionable ORF 1.436 -1.241 1 w 678 TGGACCAGCAAA 1 w 678 TGGACCAGCAAA membrane trafficking; secretion (putative) unknown G1 298 486 YDL018C YDL018C ERP3 YPD SGD MIPS 1.46 1.01 1.20 0.83 1.87 1.28 1.55 0.65 undocumented New Protein with similarity to Yal007p 4.596 -1.445 3 w168 ccaACGCGTcct w130 agaACGCGTtct c 241 cctACGCGatcat 2 w168 ccaACGCGTcct w130 agaACGCGTtct 1 c 241 cctACGCGatcat unknown "similar to glucan 1,4-alpha-glucosidase" G2/M 749 8 YDL037C YDL037C YDL037C YPD SGD MIPS 1.14 1.72 1.40 0.71 1.20 1.67 1.18 0.85 undocumented New "Protein with similarity to glucan 1,4-alpha-glucosidase " 2.615 1.237 1 c 484 aggCACGAAAaaa 1 w 472 tacACGCGcacat unknown unknown G2/M 746 7 YDL039C YDL039C YDL039C YPD SGD MIPS 1.75 2.50 2.09 0.48 1.18 1.82 1.47 0.68 undocumented New Protein of unknown function 2.295 1.268 1 w 656 TCAACCAGCCAA tRNA splicing unknown G2/M 681 43 YDL048C STP4 STP4 YPD SGD MIPS 1.19 1.19 1.00 1.00 1.11 1.54 1.18 1.18 undocumented New Protein involved in tRNA splicing and branched-chain amino acid uptake 1.314 1.752 mannose metabolism mannose-1-phosphate guanyltransferase G1 410 787 YDL055C PSA1 PSA1 YPD SGD MIPS 4.61 2.86 3.63 3.63 2.60 2.86 2.73 0.37 lethal Known "Mannose-1-phosphate guanyltransferase, GDP-mannose pyrophosphorylase" 6.980 -2.342 2 w 118 ttgACGCGccaaa w 99 aatACGCGatatt 2 w 118 ttgACGCGccaaa w 99 aatACGCGatatt unknown unknown M/G1 42 327 YDL089W YDL089W YDL089W YPD SGD MIPS 1.35 1.11 1.10 1.10 1.29 1.14 1.21 0.83 undocumented New novel 1.660 0.099 1 c 400 acaCGCGAAAgtg 1 c 399 aacACGCGaaagt protein glycosylation dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase G1 326 436 YDL093W PMT5 PMT5 YPD SGD MIPS 3.21 1.18 1.95 1.95 1.36 1.22 1.29 0.78 undocumented New "Protein with similarity to O-mannosyltransferases Pmt1p, Pmt2p, Pmt3p, Pmt4p, and Pmt6p " 2.060 -1.571 1 w159 tgcCGCGAAAagt 1 w159 tgcCGCGAAAagt protein glycosylation dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase G1 325 773 YDL095W PMT1 PMT1 YPD SGD MIPS 3.92 2.33 3.02 3.02 1.77 1.20 1.46 0.68 viable New "Mannosyltransferase (dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase), first step in O-glycosylation; lots of PMT genes appear to be coregulated" 1.520 -1.571 unknown unknown G1 352 553 YDL096C YDL096C YDL096C YPD SGD MIPS 2.88 1.89 2.33 2.33 1.72 1.11 1.24 0.80 undocumented New novel; questionable ORF 2.148 -1.701 1 w 61 CACACCAGCATA DNA repair DNA damage-responsive protein kinase G1 320 474 YDL101C DUN1 DUN1 YPD SGD MIPS 2.14 1.27 1.65 1.65 1.13 1.11 1.01 1.01 undocumented New Protein kinase necessary for induction of Rnr3p and DNA repair genes after DNA damage 3.290 -1.561 2 w166 gcgACGCGTttg w 171 gtgACGCGACGCG 1 w166 gcgACGCGTttg 1 w 171 gtgACGCGACGCG DNA replication DNA polymerase delta catalytic 125 KD subunit G1 147 454 YDL102W CDC2 CDC2 YPD SGD MIPS 1.56 1.82 1.69 1.69 1.38 1.52 1.45 0.69 lethal Known "aka POL3; DNA polymerase delta large subunit, has intrinsic 3'-5' exonuclease" 2.010 -0.709 1 w 453 TTTCCCGTTTAGGAAA 1 w 493 tgaCGCGAAAgtt 1 w 511 gtgACGCGTcac 2 w 494 atgACGCGaaagt c 526 caaACGCGggtaa unknown unknown G1 193 550 YDL103C QRI1 QRI1 YPD SGD MIPS 2.85 1.51 2.07 2.07 1.22 1.28 1.25 0.80 lethal New aka UAP1; UDP-N-acetylglucosamine pyrophosphorylase; involved in chitin synthesis 2.725 -0.998 1 w133 gttACGCGTaat 1 w133 gttACGCGTaat unknown unknown G1 186 440 YDL105W QRI2 QRI2 YPD SGD MIPS 1.22 1.54 1.37 1.37 1.60 1.49 1.54 0.65 lethal New Protein of unknown function 1.561 -0.955 2 w111 gcaACGCGTtaa w 118 gaaACGCGcaacg 1 w111 gcaACGCGTtaa 1 w 118 gaaACGCGcaacg unknown unknown M/G1 26 282 YDL117W YDL117W YDL117W YPD SGD MIPS 1.15 1.02 1.08 0.92 1.60 1.28 1.43 0.70 undocumented New low similiarity to SRP40 5.967 0.286 1 C 451 CAAACCAGCCAT 1 C 451 CAAACCAGCCAT cell cycle G1/S cyclin G1 141 566 YDL127W PCL2 PCL2 YPD SGD MIPS 3.82 1.60 2.47 2.47 1.68 1.54 1.61 0.62 viable Known "Cyclin, found partly in association with Pho85p " 6.332 -0.672 7 w158 aatCGCGAAAaga c454 caaCGCGAAAatg c468 ccaCGCGAAAaga c502 caaCGCGAAAaat c 453 ccaACGCGaaaat c 467 accACGCGaaaag c 501 acaACGCGaaaaa 4 w158 aatCGCGAAAaga c454 caaCGCGAAAatg c468 ccaCGCGAAAaga c502 caaCGCGAAAaat 3 c 453 ccaACGCGaaaat c 467 accACGCGaaaag c 501 acaACGCGaaaaa transport vacuolar H+/Ca(2+) exchanger G2/M 775 204 YDL128W VCX1 VCX1 YPD SGD MIPS 1.14 1.52 1.31 0.76 1.12 1.57 1.18 1.18 viable New Calcium transport (H+/Ca++ exchange) protein of the vacuolar membrane 1.551 0.917 transport glucose permease G2/M 787 64 YDL138W RGT2 RGT2 YPD SGD MIPS 1.38 1.38 1.38 0.72 1.42 1.20 1.09 0.92 undocumented New "Glucose transporter responsible for induction of gene expression in the presence of high glucose, member of the sugar permease family " 2.069 0.756 unknown unknown G1 156 441 YDL156W YDL156W YDL156W YPD SGD MIPS 1.26 1.73 1.48 1.48 1.77 1.22 1.47 0.68 undocumented New weak similarity to Pas7p 1.720 -0.763 1 w193 attACGCGTttt 1 w193 attACGCGTttt unknown unknown G1 373 606 YDL157C YDL157C YDL157C YPD SGD MIPS 1.94 1.26 1.56 1.56 1.48 1.69 1.58 0.63 undocumented New novel 1.995 -1.899 1 w148 aaaACGCGTaat 1 w148 aaaACGCGTaat unknown unknown G1 188 515 YDL163W YDL163W YDL163W YPD SGD MIPS 2.16 2.61 2.37 2.37 1.54 1.33 1.43 0.70 undocumented New novel; questionable ORF 2.562 -0.970 DNA replication and repair DNA ligase G1 159 516 YDL164C CDC9 CDC9 YPD SGD MIPS 3.12 2.66 2.88 2.88 1.57 1.19 1.37 0.73 undocumented Known DNA ligase; level of mRNA is cell-cycle regulated and reaches maximum near the G1/S boundary 2.940 -0.776 4 w440 tttCACGAAAaaa w183 ctaACGCGTtta w131 gcgACGCGTaac w 136 gaaACGCGACGCG 1 w440 tttCACGAAAaaa 2 w183 ctaACGCGTtta w131 gcgACGCGTaac 1 w 136 gaaACGCGACGCG 1 c 340 CTTACCAGCCGG 1 c 387 TTTCCCTTTTAGGAAA unknown unknown M/G1 98 318 YDL169C UGX2 UGX2 YPD SGD MIPS 1.51 1.05 1.20 0.83 1.33 1.15 1.24 0.81 undocumented New Protein of unknown function 1.652 -0.413 1 w 57 AGTACCAGCGTT 1 w 57 AGTACCAGCGTT cell cycle cyclin (Pho85p) M/G1 4 269 YDL179W PCL9 PCL9 YPD SGD MIPS 1.90 1.10 1.45 0.69 1.04 1.61 1.30 0.77 viable Known Pho85 cyclin 3.296 0.526 3 w 328 GAAACCAGCGTC w 328 GAAACCAGCGTC w 284 AAAACCAGCTCA 2 w 328 GAAACCAGCGTC w 284 AAAACCAGCTCA 1 w 328 GAAACCAGCGTC unknown unknown G2/M 699 157 YDL180W YDL180W YDL180W YPD SGD MIPS 1.86 1.10 1.30 1.30 1.50 1.11 1.16 0.86 undocumented New Protein of unknown function 1.383 1.631 transcription anti-silencing protein G1 195 509 YDL197C ASF2 ASF2 YPD SGD MIPS 2.17 1.58 1.85 1.85 1.74 2.00 1.86 0.54 viable Known Anti-silencing protein that causes depression of silent loci when overexpressed 1.714 -1.005 2 w183 acgACGCGTatt w153 ctaACGCGTttt 2 w183 acgACGCGTatt w153 ctaACGCGTttt c 499 AAAAATGCGGGG unknown unknown G1 367 467 YDL211C YDL211C YDL211C YPD SGD MIPS 1.67 1.41 1.53 1.53 1.74 1.41 1.57 0.64 undocumented New similarity to hypothetical protein YNL176c 2.957 -1.835 2 c160 tgaCGCGAAAtct c 159 ctgACGCGaaatc 1 c160 tgaCGCGAAAtct 1 c 159 ctgACGCGaaatc homothallic switching endonuclease G1 220 414 YDL227C HO HO YPD SGD MIPS 1.42 1.47 1.44 1.44 1.41 1.13 1.26 0.79 viable Known "Homothallic switching endonuclease, initiates mating type interconversion by making a double-stranded break in the expressed MAT gene " 2.861 -1.137 3 w301 tcgCGCGAAAaaa c306 tcgCGCGAAAaga w236 attACGCGTcgt 2 w301 tcgCGCGAAAaaa c306 tcgCGCGAAAaga 1 w236 attACGCGTcgt trehalose metabolism "alpha,alpha-trehalase" G1 151 25 YDR001C NTH1 YDR001C YPD SGD MIPS 1.42 1.02 1.18 1.18 1.02 1.33 1.16 0.86 viable New "Neutral trehalase (alpha, alpha-trehalase)" 1.391 -0.726 1 c 424 agtACGCGgaaaa 1 c 424 agtACGCGgaaaa 4-nitroquinoline-N-oxide resistance putative ATP-dependent permease S/G2 579 186 YDR011W SNQ2 SNQ2 YPD SGD MIPS 1.14 1.50 1.31 1.31 1.81 1.02 1.36 0.74 viable New Multidrug resistance protein of the ATP-binding cassette (ABC) superfamily 1.560 2.506 unknown unknown S/G2 592 616 YDR029W YDR029W YDR029W YPD SGD MIPS 1.06 1.75 1.36 1.36 1.50 1.48 1.49 0.67 undocumented New Protein of unknown function 1.333 2.426 unknown similar to Yro2p G2/M 751 92 YDR033W YDR033W YDR033W YPD SGD MIPS 5.74 4.09 4.85 0.21 11.13 6.23 8.33 8.33 undocumented Known High similarity to YRO2 (see above) 11.640 1.208 w 436 AAAATACCGGGG unknown unknown G1 278 605 YDR053W YDR053W YDR053W YPD SGD MIPS 2.25 1.52 1.85 1.85 1.62 1.39 1.50 0.67 undocumented New novel; questionable ORF 1.317 -1.366 1 w 594 actACGCGcttat 1 w 594 actACGCGcttat w 112 CCCTATTTGGTTGCAATTCAATTCCGTGAAACC unknown similar to members of the Sps2p-Ecm33p-Ycl048p M/G1 32 265 YDR055W YDR055W PTS1 YPD SGD MIPS 3.69 4.67 4.15 0.24 1.03 1.55 1.26 0.79 undocumented New "similar to ECM33, which is involved in cell wall metabolism in some manner" 7.266 0.176 unknown putative cell surface glycoprotein G2/M 800 67 YDR077W SED1 SED1 YPD SGD MIPS 2.46 4.17 3.20 0.31 1.11 1.19 1.04 0.97 viable Known "Abundant cell surface glycoprotein, overexpression suppresses growth defect of erd2 " 3.256 0.565 1 w 47 GACACCAGCGAG mating "cytoskeletal protein, similar to arrestins" M/G1 63 315 YDR085C AFR1 AFR1 YPD SGD MIPS 2.85 1.37 1.97 0.51 1.45 1.23 1.34 1.34 viable New Protein involved in morphogenesis of the mating projection (shmoo) 2.633 -0.110 unknown unknown S/G2 574 676 YDR089W YDR089W YDR089W YPD SGD MIPS 1.69 1.43 1.56 1.56 2.02 1.09 1.48 1.48 undocumented New "novel, with leucine zipper" 2.779 2.542 DNA repair MutS homolog; mismatch repair G1 227 532 YDR097C MSH6 MSH6 YPD SGD MIPS 3.82 3.17 3.48 3.48 1.54 1.25 1.39 0.72 viable Known "Component with Msh2p of DNA mismatch binding factor, involved in repair of single base mismatches" 8.874 -1.163 3 w260 aaaCGCGAAAtat w 261 caaACGCGaaata c 297 ttgACGCGaatta 1 w260 aaaCGCGAAAtat 2 w 261 caaACGCGaaata c 297 ttgACGCGaatta cell cycle anaphase inhibitor (putative) G1 396 752 YDR113C PDS1 PDS1 YPD SGD MIPS 4.28 1.60 2.62 2.62 1.14 1.79 1.43 0.70 viable New Protein that may regulate sister chromatid separation in mitosis 6.298 -2.148 1 w187 caaACGCGTcaa 1 w187 caaACGCGTcaa 1 c 588 TCTGCCAGCCTC unknown unknown S/G2 542 672 YDR130C YDR130C YDR130C YPD SGD MIPS 1.90 1.08 1.33 1.33 1.26 1.49 1.37 1.37 undocumented New "weak similarity to sea urchin myosin heavy chain, has possible coiled-coil region " 2.892 2.970 protein degradation periplasmic aspartyl protease G1 274 729 YDR144C YPS2 MKC7 YPD SGD MIPS 2.05 1.85 1.95 1.95 1.80 1.01 1.35 0.74 viable New "Aspartyl protease of the periplasmic space, has similarity to Yap3p and Bar1p" 1.369 -1.363 2 w273 tacACGCGTttt c 488 tatACGCGgcgaa 1 w273 tacACGCGTttt 1 c 488 tatACGCGgcgaa c 633 AAACATGTGGGG cell cycle "transcription factor, regulates HO" G2/M 668 237 YDR146C SWI5 SWI5 YPD SGD MIPS 1.18 1.43 1.10 1.10 4.84 4.21 4.51 4.51 viable Known transcription factor for M/G1 regulated genes 6.726 1.866 1 GTACTTTAACCTGTTTAGGAAAAAG GTAAACAATAACA 1 GTACTTTAACCTGTTTAGGAAAAAG GTAAACAATAACA unknown unknown S/G2 570 697 YDR149C YDR149C SGD MIPS 1.08 2.77 1.73 1.73 1.04 1.19 1.07 0.94 undocumented New questionable ORF 2.562 2.588 1 w 536 gtaACGCGatcat 1 w 536 gtaACGCGatcat "mitosis, nuclear migration" unknown S/G2 605 207 YDR150W NUM1 NUM1 YPD SGD MIPS 1.08 1.49 1.17 1.17 1.37 1.27 1.04 0.96 viable Known "Nuclear migration protein, controls interaction of bud-neck cytoskeleton with G2 nucleus" 2.306 2.309 1 w 585 agtACGCGTcgc unknown unknown M/G1 20 5 YDR157W YDR157W YDR157W YPD SGD MIPS 1.35 1.27 1.31 0.76 3.55 1.08 1.81 0.55 undocumented New questionable ORF 1.316 0.308 1 w 190 AACACCAGCCTC 2 w 216 ctgACGCGgacgc c 700 tccACGCGcttcc 1 w 190 AACACCAGCCTC unknown unknown G2/M 779 98 YDR190C YDR190C YDR190C YPD SGD MIPS 1.12 1.56 1.18 0.85 1.04 1.91 1.41 1.41 undocumented New "Protein of unknown function, has an ATP/GTP binding motif " 1.347 0.821 1 w 668 TATACCAGCGGC c 304 AAATCGCCGGGG silencing (telomere) similar to nuclear lamins M/G1 24 76 YDR191W HST4 HST4 YPD SGD MIPS 1.71 1.27 1.47 0.68 2.00 1.46 1.71 1.71 viable New Protein with similarity to Sir2p 5.955 0.293 1 w 581 ACCACCAGCTAA 1 w 581 ACCACCAGCTAA chromatin structure histone H2B S 432 794 YDR224C HTB1 HTB1 YPD SGD MIPS 3.16 1.91 2.46 2.46 1.65 1.16 1.39 0.72 viable Known Histone H2B (HTB1 and HTB2 code for nearly identical proteins) 10.380 -2.492 4 c 425 gggCGCGAAAtgc w 402 gagACGCGaagct c 147 gcaACGCGagaga c 294 ttcACGCGcttaa 1 c 425 gggCGCGAAAtgc 3 w 402 gagACGCGaagct c 147 gcaACGCGagaga c 294 ttcACGCGcttaa chromatin structure histone H2A S 437 796 YDR225W HTA1 HTA1 YPD SGD MIPS 2.69 2.78 2.73 2.73 1.32 1.32 1.32 0.76 viable Known Histone H2A (HTA1 and HTA2 code for identical proteins) 10.680 -2.534 1 w 341 agaACGCGgtttc 1 w 341 agaACGCGgtttc unknown putative protein kinase S 466 698 YDR247W YDR247W YDR247W YPD SGD MIPS undocumented New Serine/threonine protein kinase with similarity to S. pombe RAN1 negative regulator of sexual conjugation and meiosis (GB:Z49701) 2.096 -2.823 1 c 531 cggACGCGgacc 1 c 531 cggACGCGgacc cell wall biogenesis "exo-beta-1,3-glucanase" S 456 782 YDR261C EXG2 EXG2 YPD SGD MIPS 3.87 2.23 2.94 2.94 1.33 1.43 1.38 0.73 undocumented New "Exo-beta-1,3-glucanase (beta-1,3-D-glucanglucanohydrolase), minor isoform" 1.932 -2.705 2 w 163 tccCGCGAAAaaa c 59 agaACGCGctaaa 1 w 163 tccCGCGAAAaaa 1 c 59 agaACGCGctaaa unknown unknown G2/M 670 115 YDR276C YDR276C YDR276C YPD SGD MIPS 1.36 1.45 1.41 0.71 1.44 1.07 1.16 0.86 undocumented New Abundant protein of unknown function 1.314 1.845 1 c 457 attACGCGcacgg unknown unknown G1 305 468 YDR279W YDR279W YDR279W YPD SGD MIPS 1.94 1.56 1.74 1.74 1.98 1.11 1.48 0.67 undocumented New novel 2.199 -1.476 2 c432 attCACGAAAgaa w193 acaACGCGTttt 1 c432 attCACGAAAgaa 1 w193 acaACGCGTttt sphingolipid metabolism hydroxylase G1 392 780 YDR297W SUR2 SUR2 YPD SGD MIPS 5.41 3.40 4.29 4.29 2.12 1.61 1.85 0.54 viable New Hydroxylase involved in sphingolipid metabolism 2.471 -2.111 3 c149 aaaCACGAAAcga w433 gaaACGCGTttt c 329 aggACGCGgggtg 1 c149 aaaCACGAAAcga 1 w433 gaaACGCGTttt 1 c 329 aggACGCGgggtg unknown similar to GPI-anchor biosynthesis protein PIG-F S/G2 522 706 YDR302W YDR302W YDR302W YPD SGD MIPS 1.23 1.14 1.18 0.85 1.94 1.16 1.50 0.67 undocumented New Protein with similarity to GPI-anchor biosynthesis protein PIG-F 1.953 3.082 1 w 153 gtaACGCGgggat 1 w 153 gtaACGCGgggat unknown similar to Pmt1p G1 235 555 YDR307W YDR307W YDR307W YPD SGD MIPS 2.84 1.60 2.13 2.13 1.10 1.34 1.10 0.91 undocumented New Protein with similarity to Pmt1p 1.464 -1.208 bud emergence binds Cdc42p G1 119 561 YDR309C GIC2 GIC2 YPD SGD MIPS 6.26 1.51 3.07 3.07 1.90 1.96 1.93 0.52 viable Known "Putative effector of Cdc42p, important for bud emergence" 4.287 -0.547 2 c140 agaCACGAAAcaa w392 aagACGCGTtct 1 c140 agaCACGAAAcaa 1 w392 aagACGCGTtct 1 w 378 TTTCCCTAATAGGAAA protein synthesis "ribosomal protein, mitochondrial S28" G2/M 789 62 YDR337W MRPS28 MRPS28 YPD SGD MIPS 1.01 1.45 1.20 0.83 1.08 1.37 1.22 0.82 viable New Mitochondrial ribosomal protein of the small subunit (E. coli S15) 1.699 0.690 1 w 190 TCAACCAGCTTT transport hexose permease M/G1 23 12 YDR342C HXT7 HXT7 YPD SGD MIPS 3.90 1.85 2.69 0.37 1.91 1.52 1.71 0.59 viable New "High-affinity hexose transporter, member of the sugar permease family (HXT6 and HXT7 genes differ by 2 base pairs) " 1.465 0.301 unknown unknown S/G2 576 663 YDR346C YDR346C YDR346C YPD SGD MIPS 1.40 1.16 1.10 1.10 1.55 1.07 1.20 0.83 undocumented New has similarity to YDR222W and YLR225C 1.509 2.521 1 c 222 TCAACCAGCTGT c 634 AAACATGTGGGG pyrimidine biosynthesis thioredoxin reductase G1 346 385 YDR353W TRR1 TRR1 YPD SGD MIPS 1.14 1.04 1.04 1.04 1.15 1.06 1.04 0.96 viable New Thioredoxin reductase 2.147 -1.651 1 w139 cccACGCGTata 1 w139 cccACGCGTata unknown unknown S 425 797 YDR355C YDR355C YDR355C YPD SGD MIPS 1.19 1.80 1.46 1.46 1.49 1.08 1.27 0.79 undocumented New Protein of unknown function 3.671 -2.428 cytoskeleton spindle pole body component G1 406 722 YDR356W NUF1 NUF1 YPD SGD MIPS 1.16 2.26 1.62 1.62 1.61 1.10 1.21 0.83 lethal Known "aka SPC110; Spindle pole body component with coiled-coil structure, determines the spacing between the ends of microtubules and the central plaque " 3.005 -2.257 unknown similar to aldo-keto reductases G1 148 341 YDR368W YPR1 YPR1 YPD SGD MIPS 1.31 1.45 1.38 1.38 1.25 1.35 1.30 1.30 undocumented New Protein with similarity to members of the aldo/keto reductase family 1.385 -0.711 unknown "similar to pyruvate decarboxylase, pyruvate" G2/M 771 130 YDR380W YDR380W YDR380W YPD SGD MIPS 1.89 1.78 1.03 0.97 1.09 1.00 1.04 0.96 undocumented New "Protein with similarity to pyruvate decarboxylase, pyruvate oxidase, acetolactate synthase (large subunit), and other enzymes that require thiamine pyrophosphate " 1.697 0.953 1 w 55 ttgACGCGacttc unknown similar to E. coli protein G1 335 472 YDR400W YDR400W YDR400W YPD SGD MIPS 3.59 1.11 2.00 2.00 1.91 1.10 1.32 0.76 undocumented New similarity to C. fasciculata inosine-uridine preferring nucleoside hydrolase 2.451 -1.601 1 w 39 gtaACGCGatatt 1 w 39 gtaACGCGatatt mRNA export; protein import nuclear shuttling protein G2/M 698 111 YDR432W NPL3 NPL3 YPD SGD MIPS 1.05 1.28 1.16 0.86 1.62 1.18 1.38 0.72 lethal New "Protein involved in 18S and 25S rRNA processing, export of RNA from the nucleus, import of proteins into the nucleus, and associated with U1 snRNP, has 2 RNA recognition (RRM) domains " 1.469 1.631 "meiosis, checkpoint; transcriptional silencing " unknown G1 267 383 YDR440W PCH1 DOT1 YPD SGD MIPS 1.82 1.07 1.30 0.77 1.83 1.21 1.23 0.81 viable New Protein required for cell cycle arrest at the pachytene stage of meiosis in a zip1 mutant 2.045 -1.316 1 w176 cgcACGCGTcaa 1 w176 cgcACGCGTcaa chromatin structure histone acetyltransferase complex subunit S 470 658 YDR448W ADA2 ADA2 YPD SGD MIPS 1.10 1.54 1.18 1.18 1.42 1.42 1.00 1.00 viable New Component of the nucleosomal histone acetyltransferase (Spt-Ada-Gcn5-Acetyltransferase or SAGA) complex 1.465 -2.867 1 c 300 aagACGCGcattg 1 c 300 aagACGCGcattg 1 c 632 GGGACCAGCAGG 1 c 632 GGGACCAGCAGG unknown "similar to Yox1p, which binds Leu-tRNA (SP:P34161)" S 469 734 YDR451C YDR451C YDR451C YPD SGD MIPS 3.06 1.24 1.95 1.95 2.34 1.47 1.86 0.54 undocumented New Protein with similarity to Yox1p 3.066 -2.855 2 w 313 atgACGCGcgcca w 279 cagACGCGctttc 2 w 313 atgACGCGcgcca w 279 cagACGCGctttc 1 w 68 CTCGCCAGCCAG w 224 CCCAAAAAGGAAATTTACATGTTAAATGAAACC mating a-factor precursor G1 333 3 YDR461W MFA1 MFA1 YPD SGD MIPS 5.07 1.32 2.58 0.39 1.61 1.43 1.06 1.06 viable New "Mating pheromone a-factor, exported from cell by Ste6p " 1.440 -1.601 phosphate metabolism vacuolar alkaline phosphatase G1 163 554 YDR481C PHO8 PHO8 YPD SGD MIPS 4.09 1.03 1.99 1.99 1.31 2.22 1.30 0.77 undocumented New "Alkaline phosphatase (ALP), repressible (vacuolar), carries out dephosphorylation of phosphopeptides " 2.677 -0.792 4 c90 gagCACGAAAaaa w 18 tgaACGCGcatta c 158 tctACGCGcgaag c 220 tagACGCGcctta 1 c90 gagCACGAAAaaa 3 w 18 tgaACGCGcatta c 158 tctACGCGcgaag c 220 tagACGCGcctta 2 w 447 AAGGCCAGCCAT w 72 TTTGCCAGCAAG unknown unknown G1 386 721 YDR488C PAC11 PAC11 YPD SGD MIPS 1.19 1.42 1.09 1.09 1.53 1.10 1.30 0.77 viable New "Protein with similarity to rat dynein intermediate chain, required in the absence of Cin8p " 1.963 -2.052 1 c95 aaaCACGAAAact 1 c95 aaaCACGAAAact unknown unknown M/G1 22 299 YDR493W YDR493W YDR493W YPD SGD MIPS 1.58 1.37 1.47 0.68 1.21 1.56 1.38 0.73 undocumented New Protein of unknown function 1.764 0.302 unknown unknown G1 341 416 YDR501W YDR501W YDR501W YPD SGD MIPS 1.21 1.07 1.14 1.14 1.20 1.16 1.18 0.85 undocumented New similarity to hypothetical protein YLR183c 2.864 -1.621 3 c220 aaaCGCGAAAaaa w 235 caaACGCGataat c 219 caaACGCGaaaaa 1 c220 aaaCGCGAAAaaa 2 w 235 caaACGCGataat c 219 caaACGCGaaaaa phospholipid metabolism lipid phosphate phosphatase G1 247 487 YDR503C LPP1 LPP1 YPD SGD MIPS 1.36 1.22 1.29 1.29 1.04 1.18 1.11 0.90 undocumented New Lipid phosphate phosphatase 3.537 -1.250 1 w163 ttcACGCGTaag 1 w163 ttcACGCGTaag cell cycle (growth inhibitor) protein kinase G1 157 446 YDR507C GIN4 GIN4 YPD SGD MIPS 4.83 1.18 2.03 2.03 2.41 1.10 1.63 0.61 viable New "Serine/threonine-protein kinase with similarity to Ycl024p, growth inhibitory protein" 2.671 -0.766 3 w252 catCGCGAAAtat w313 gaaACGCGTcaa w 290 actACGCGcaatc 1 w252 catCGCGAAAtat 1 w313 gaaACGCGTcaa 1 w 290 actACGCGcaatc unknown unknown G1 178 403 YDR528W YDR528W YDR528W YPD SGD MIPS 1.50 1.82 1.10 0.91 1.23 1.16 1.03 0.97 undocumented New "has similarity to LRE1, a protein involved in laminarinase resistance " 3.035 -0.912 1 w476 ttcACGCGTgct 1 w476 ttcACGCGTgct unknown similar to subtelomerically-encoded proteins M/G1 47 600 YDR545W YDR545W YDR545W YPD SGD MIPS 2.11 1.10 1.52 1.52 1.14 1.40 1.11 1.11 undocumented New Protein with similarity to other subtelomerically-encoded proteins 1.567 0.038 1 w 590 ctgACGCGccata unknown unknown S/G2 529 680 YEL017W YEL017W YEL017W YPD SGD MIPS 2.05 1.09 1.37 1.37 1.15 1.01 1.07 1.07 viable New Protein of unknown function 2.650 3.053 unknown unknown G2/M 740 185 YEL025C YEL025C YEL025C YPD SGD MIPS 1.09 1.01 1.04 0.96 1.01 1.12 1.05 0.95 viable New Protein of unknown function 1.527 1.322 1 w 157 tgaACGCGcttg DNA replication MCM initiator complex M/G1 5 72 YEL032W MCM3 MCM3 YPD SGD MIPS 2.41 1.02 1.54 0.65 1.49 1.15 1.14 1.14 lethal New Member of the MCM/P1 family that acts at ARS elements to initiate replication 5.661 0.521 1 c 185 TTACCCATTTAGGAAA c 627 TATCTCCCGGGG unknown unknown M/G1 43 560 YEL040W UTR2 UTR2 YPD SGD MIPS 2.72 1.48 2.01 2.01 1.48 1.27 1.08 0.93 viable New protein with similarity to YLR213C and YGR189C both of which have unknown functions 2.073 0.096 1 w 240 aagCGCGAAAatt 1 c 415 caaACGCGcatga Golgi organization Golgi membrane guanosine diphosphatase S 481 760 YEL042W GDA1 GDA1 YPD SGD MIPS 2.92 1.32 1.96 1.96 1.48 1.10 1.16 0.86 viable New converts GDP released from GDP-mannose to GMP which is returned to cytoplasm by an antiporter 1.920 -2.970 unknown putative fumarate reductase G1 372 750 YEL047C YEL047C YEL047C YPD SGD MIPS 4.89 1.29 2.51 2.51 1.22 1.32 1.04 0.96 viable New Cytoplasmic soluble fumarate reductase 2.425 -1.889 2 w 126 gcaACGCGTcgc c 121 ggaACGCGacgc 1 w 126 gcaACGCGTcgc 1 c 121 ggaACGCGacgc 1 protein degradation vacuolar protease B S 453 352 YEL060C PRB1 PRB1 YPD SGD MIPS 1.27 1.28 1.01 0.99 1.61 1.31 1.11 0.90 viable New "Protease B (yscB) (PrB) (cerevisin), serine protease of the subtilisin family with broad proteolytic specificity " 1.512 -2.646 "mitosis, spindle maintenance" kinesin related protein S 414 732 YEL061C CIN8 CIN8 YPD SGD MIPS 1.89 1.22 1.52 1.52 2.11 1.12 1.54 0.65 viable New Kinesin-related protein involved in establishment and maintenance of mitotic spindle 2.368 -2.363 3 c 127 acaCACGAAAacg w 98 gtaCGCGAAAtaa w 99 ggtACGCGaaata 1 c 127 acaCACGAAAacg 1 w 98 gtaCGCGAAAtaa 1 w 99 ggtACGCGaaata w 506 ATCAAAGTGGGG unknown similar to members of the major facilitator G1 225 384 YEL064C YEL064C YEL064C YPD SGD MIPS 1.20 1.16 1.18 0.85 1.79 1.02 1.35 0.74 viable New Protein with similarity to members of the major facilitator superfamily (MFS) 1.459 -1.160 unknown "similar to hexose transporters, member of" G2/M 712 193 YEL065W YEL065W YEL065W YPD SGD MIPS 2.03 1.29 1.25 0.80 1.04 1.25 1.14 1.14 viable New Member of major facilitator superfamily (MFS) multidrug-resistance (MFS-MDR) protein family 3.458 1.571 1 w 634 tgaACGCGcaag unknown unknown S 447 377 YEL068C YEL068C YEL068C YPD SGD MIPS 1.30 1.63 1.12 1.12 1.21 1.01 1.10 0.91 viable New Protein of unknown function 5.047 -2.593 unknown similar to other subtelomerically-encoded proteins G1 120 569 YEL075C YEL075C YEL075C YPD SGD MIPS 1.40 1.04 1.16 1.16 1.21 1.15 1.18 0.85 undocumented New "Protein with similarity to other subtelomerically-encoded proteins including Yhl049p, Yil177p, and Yjl225p " 4.200 -0.549 1 w 544 ctgACGCGccat 1 w 544 ctgACGCGccat unknown similar to other subtelomerically-encoded proteins G1 118 570 YEL076C YEL076C YEL076C YPD SGD MIPS 1.55 1.35 1.07 1.07 1.41 1.01 1.18 0.85 undocumented New Protein with similarity to other subtelomerically-encoded proteins 4.076 -0.538 1 w 151 tgtCACGAAAtag 1 w 151 tgtCACGAAAtag unknown unknown G1 184 578 YEL076C-A YEL076CA YEL076C-A YPD SGD undocumented New Protein with similarity to other subtelomerically-encoded protein (YPL283 and YGR296W code for identical proteins) 3.149 -0.951 1 w 151 tgtCACGAAAtag 1 w 151 tgtCACGAAAtag protein glycosylation "alpha-1,3-mannosyltransferase" G1 359 471 YER001W MNN1 MNN1 YPD SGD MIPS 7.10 1.39 2.26 2.26 3.57 1.11 1.99 0.50 viable Known "Alpha-1,3-mannosyltransferase, required for complex glycosylation of both N- and O-oligosaccharides" 7.599 -1.762 3 w50 gaaCGCGAAAaga w36 aagACGCGTctc w 51 agaACGCGaaaag 1 w50 gaaCGCGAAAaga 1 w36 aagACGCGTctc 1 w 51 agaACGCGaaaag mannose metabolism mannose-6-phosphate isomerase S 451 786 YER003C PMI40 PMI40 YPD SGD MIPS 5.86 1.43 2.02 2.02 2.09 1.06 1.49 0.67 lethal New "Mannose-6-phosphate isomerase, generates mannose-6-phosphate for synthesis of GDP-mannose and dolichol-phosphate-mannose " 3.868 -2.629 3 c 181 cagCACGAAAtgg c 148 cggACGCGacaaa c 559 tatACGCGatctt 1 c 181 cagCACGAAAtgg 2 c 148 cggACGCGacaaa c 559 tatACGCGatctt cytoskeleton microtubule binding protein G1 371 608 YER016W BIM1 BIM1 YPD SGD MIPS 2.37 1.24 1.71 1.71 1.98 1.14 1.32 0.76 viable New Protein with affect on microtubule structure 2.001 -1.889 2 w123 actACGCGTttg w 131 ctaACGCGactac 1 w123 actACGCGTttg 1 w 131 ctaACGCGactac cytoskeleton spindle pole body component S/G2 496 627 YER018C YER018C SPC25 YPD SGD MIPS 1.80 1.26 1.20 0.84 1.80 1.01 1.35 0.74 lethal New Protein of unknown function 2.317 -3.061 1 w 152 tttACGCGgaaa 1 w 152 tttACGCGgaaa unknown similar to mammalian neutral G1 403 630 YER019W YER019W YER019W YPD SGD MIPS 1.18 1.20 1.01 0.99 1.24 1.30 1.27 0.79 viable New "Protein with weak similarity to mammalian neutral sphingomyelinases, has motifs typical of ATP/GTP-binding sites " 2.330 -2.234 3 c 32 tttACGCGgaaa c 272 accACGCGcgcc c 549 attACGCGcacg 3 c 32 tttACGCGgaaa c 272 accACGCGcgcc c 549 attACGCGcacg 2 c 184 ATGGCCAGCATA c 637 GGAGCCAGCGAT mRNA 3'-end processing unknown S/G2 520 699 YER032W FIR1 FIR1 YPD SGD MIPS 1.00 1.18 1.09 0.92 1.70 1.08 1.25 0.80 viable New "Protein that interacts with Pap1p and Ref2p, probably involved in 3'-mRNA processing" 2.963 3.093 1 c 137 TAGGCCAGCAAA 1 c 137 TAGGCCAGCAAA oxidative stress response peptide-methionine sulfoxide reductase S/G2 518 639 YER042W YER042W MXR1 YPD SGD MIPS 1.30 1.18 1.05 1.05 1.42 1.10 1.14 0.88 viable New Peptide-methionine sulfoxide reductase involved in cellular antioxidation 2.851 3.105 DNA replication ribonucleotide reductase G1 179 514 YER070W RNR1 RNR1 YPD SGD MIPS 8.04 1.71 3.71 3.71 6.05 1.08 2.55 0.39 lethal Known ribonucleotide reductase; regulated through a Mlu1 cell cycle box (MCB) element 4.600 -0.927 2 w123 gaaACGCGTtag w111 gaaACGCGTtct 2 w123 gaaACGCGTtag w111 gaaACGCGTtct 2 c 391 CATACCAGCTAG c 685 TGGGCCAGCCTG methionine biosynthesis homocysteine methyltransferase S 457 656 YER091C MET6 MET6 YPD SGD MIPS 2.64 1.43 1.94 1.94 1.53 1.74 1.07 1.07 viable New "Homocysteine methyltransferase (5-methyltetrahydropteroyl triglutamate--homocysteine methyltransferase), methionine synthase, cobalamin-independent " 2.956 -2.705 c 578 ATTAGAGCGGGG DNA repair and recombination recombinase G1 303 482 YER095W RAD51 RAD51 YPD SGD MIPS 1.50 4.51 2.61 2.61 1.44 1.41 1.42 0.70 viable Known "Protein required for recombination and repair of X-ray damage, required with Dmc1p to establish interhomolog connections at meiotic recombination nodules" 6.028 -1.473 1 w118 agaACGCGTaag 1 w118 agaACGCGTaag cell cycle transcription factor M/G1 101 568 YER111C SWI4 SWI4 YPD SGD MIPS 1.03 1.27 1.11 1.11 1.66 1.12 1.22 0.82 viable Known both Swi4p and Swi6p are required for the in vivo protection of the SCB sequences at any cell cycle stage 3.239 -0.446 3 c239 ttgCGCGAAActt w447 tcaACGCGTacg w262 tttACGCGTtac 1 c239 ttgCGCGAAActt 2 w447 tcaACGCGTacg w262 tttACGCGTtac 1 w 697 ACAACCAGCTCA 1 c 394 TTACCCACTTAGGAAA "signaling, high osmolarity pathway" transmembrane osmosensor G1 366 762 YER118C SHO1 SSU81 YPD SGD MIPS 3.75 1.79 2.59 2.59 1.55 1.61 1.58 0.63 viable New "aka SHO1, Protein with an SH3 domain involved as an osmosensor in the HOG1 high-osmolarity signal transduction pathway" 2.655 -1.826 3 w301 ccaACGCGTtca c 320 aaaACGCGattaa c 374 cttACGCGgatat 1 w301 ccaACGCGTtca 2 c 320 aaaACGCGattaa c 374 cttACGCGgatat w 643 TTATACGTGGGG unknown unknown G1 271 285 YER124C YER124C YER124C YPD SGD MIPS 1.84 1.05 1.32 0.76 1.40 1.08 1.23 0.81 viable New Protein of unknown function 7.869 -1.345 2 w 401 CAAACCAGCAGT c 256 TAAACCAGCAAA transport iron permease G2/M 754 252 YER145C YER145C FTR1 YPD SGD MIPS 2.56 1.64 2.05 2.05 1.38 1.08 1.13 0.89 viable New Iron permease that mediates high-affinity iron uptake 1.952 1.119 1 c 252 cttACGCGggcg mating unknown G1 273 612 YER149C PEA2 PEA2 YPD SGD MIPS 2.46 1.40 1.86 1.86 1.14 1.30 1.07 1.07 viable New Protein involved in oriented growth toward mating partner 1.431 -1.360 1 c 145 ttgACGCGagcgc 1 c 145 ttgACGCGagcgc unknown similar to Sed1p M/G1 65 1 YER150W YER150W SPI1 YPD SGD MIPS 4.61 4.00 4.29 0.23 1.32 1.38 1.35 1.35 viable New Protein with similarity to Sed1p 1.873 -0.120 unknown unknown G1 338 365 YER152C YER152C YER152C YPD SGD MIPS 1.26 1.75 1.49 1.49 1.55 1.05 1.22 0.82 viable New Protein of unknown function 2.042 -1.611 1 w 23 acaACGCGTgct c 421 gccACGCGcaaa 1 w 23 acaACGCGTgct 1 c 421 gccACGCGcaaa purine metabolism "adenylate kinase," G1 302 448 YER170W ADK2 ADK2 YPD SGD MIPS 2.30 1.09 1.58 1.58 1.39 1.25 1.32 0.76 viable New "Adenylate kinase (GTP:AMP phosphotransferase), mitochondrial; codes for a non-functional protein in most laboratory strains" 2.612 -1.471 1 w143 attCGCGAAAacc 1 w143 attCGCGAAAacc unknown similar to subtelomerically-encoded proteins G1 116 571 YER189W YER189W YER189W YPD SGD MIPS 1.13 2.21 1.58 1.58 1.34 1.48 1.05 1.05 undocumented New "Protein with similarity to subtelomerically-encoded proteins including Yil177p, Yhl049p, and Yjl225p " 3.922 -0.536 unknown similar to other subtelomerically-encoded proteins G1 145 584 YER190W YER190W YER190W YPD SGD MIPS 1.80 2.15 1.97 1.97 1.20 1.05 1.13 0.89 undocumented New Protein with similarity to other subtelomerically-encoded proteins including Yil177p 4.419 -0.695 unknown unknown G2/M 791 6 YFL006W YFL006W YFL006W YPD SGD MIPS 1.47 1.25 1.36 0.74 1.08 1.11 1.10 0.91 undocumented New Protein of unknown function 1.369 0.683 2 w 277 TTCGCCAGCTGT c 635 TAAGCCAGCCAC c 161 AGTTTGGTGGGG "mitosis, chromosome condensation and segregation" unknown G1 217 491 YFL008W SMC1 SMC1 YPD SGD MIPS 1.24 1.31 1.27 1.27 1.68 1.20 1.42 0.70 lethal New Coiled-coil protein of the SMC family involved in chromosome condensation and segregation 1.995 -1.123 2 w125 ataACGCGTaaa w 619 tttACGCGccaaa 1 w125 ataACGCGTaaa 1 w 619 tttACGCGccaaa transport hexose permease M/G1 45 24 YFL011W HXT10 HXT10 YPD SGD MIPS 1.30 1.14 1.07 0.94 1.26 1.27 1.26 0.79 undocumented New "Hexose transporter, member of sugar permease family " 1.925 0.041 1 w 594 ggaACGCGTtga mating alpha-factor receptor G2/M 788 56 YFL026W STE2 STE2 YPD SGD MIPS 3.71 4.17 3.93 0.25 1.04 2.41 1.58 1.58 viable Known "Pheromone alpha-factor receptor, seven-transmembrane domain protein " 1.342 0.755 2 C 156 TCTGCCAGCCAA w 177 TTACCCACTTAGGAAA 1 w 207 ctcACGCGTcgg 2 w 408 ccgACGCGggtaa w 219 gcgACGCGaggcc 1 C 156 TCTGCCAGCCAA 1 w 177 TTACCCACTTAGGAAA cytoskeleton beta-tubulin S/G2 563 717 YFL037W TUB2 TUB2 YPD SGD MIPS 4.35 3.06 3.65 3.65 1.05 1.30 1.17 0.86 lethal New "Tubulin beta chain, required for mitosis and karyogamy" 2.333 2.700 1 w 104 aaaCACGAAAact 1 w 104 aaaCACGAAAact unknown unknown M/G1 15 30 YFL044C YFL044C YFL044C YPD SGD MIPS 1.54 1.39 1.46 0.68 1.39 1.09 1.13 0.89 undocumented New Protein of unknown function 1.419 0.341 c 441 TTTTCTCCGGGG unknown unknown; induced in stationary phase G1 295 409 YFL060C SNO3 SNO3 YPD SGD MIPS 1.49 1.37 1.43 1.43 1.94 1.01 1.40 0.71 undocumented New Member of stationary phase-induced gene family (SNO3 and SNO2 code for nearly identical proteins) 1.856 -1.437 1 c 176 gtgACGCGccgcc 1 c 176 gtgACGCGccgcc unknown similar to other subtelomerically-encoded proteins G1 131 572 YFL064C YFL064C YFL064C YPD SGD MIPS 1.38 2.51 1.86 1.86 1.47 1.54 1.02 1.02 undocumented New Protein with similarity to other subtelomerically-encoded proteins; overlaps with other ORFs 4.465 -0.607 1 w 574 ctgACGCGccata 1 w 574 ctgACGCGccata unknown similar to other subtelomerically-encoded proteins M/G1 54 587 YFL065C YFL065C YFL065C YPD SGD MIPS 1.47 2.02 1.72 1.72 1.21 1.20 1.21 0.83 undocumented New Protein with similarity to other subtelomerically-encoded proteins; overlaps with YFL064C 1.715 -0.010 1 w 42 tgtCACGAAAtag unknown similar to other subtelomerically-encoded proteins M/G1 68 588 YFL066C YFL066C YFL066C YPD SGD MIPS 2.22 2.88 2.53 2.53 1.25 1.33 1.03 1.03 undocumented New Protein with similarity to other subtelomerically-encoded proteins 1.809 -0.140 1 w 125 taaCGCGAAAaag 1 w 126 gtaACGCGaaaaa unknown similar to periodic clock protein M/G1 89 585 YFL067W YFL067W YFL067W YPD SGD MIPS 2.78 1.89 2.29 2.29 1.19 1.14 1.16 0.86 undocumented New Protein with similarity to periodic clock protein 2.684 -0.326 1 w 267 CTGGCCAGCCCA 1 w 267 CTGGCCAGCCCA nuclear protein targeting nuclear pore protein G2/M 797 250 YFR002W NIC96 NIC96 YPD SGD MIPS 1.14 1.18 1.16 1.16 1.55 1.04 1.27 0.79 lethal New "Nuclear pore protein (nucleoporin) that acts in a complex with Nsp1p, Nup57p, and Nup49p " 1.697 0.604 w 567 TTTACGCCGGGG glycogen metabolism glycogen synthase M/G1 76 337 YFR015C GSY1 GSY1 YPD SGD MIPS 1.57 1.01 1.26 1.26 1.91 1.47 1.67 1.67 undocumented New UDPglucose--starch glucosyltransferase (glycogen synthetase) isoform 1 1.457 -0.212 1 C 293 TTGACCAGCTAA 1 C 293 TTGACCAGCTAA "mitosis, sister chromatid cohesion (putative)" unknown G1 162 510 YFR027W YFR027W ECO1 YPD SGD MIPS 1.59 1.39 1.49 1.49 1.41 1.35 1.38 0.72 undocumented New novel 1.776 -0.783 3 c116 gtaCGCGAAAggc w137 tcaACGCGTaat c 115 agtACGCGaaagg 1 c116 gtaCGCGAAAggc 1 w137 tcaACGCGTaat 1 c 115 agtACGCGaaagg 1 w 78 GATGCCAGCTAC sulfate assimilation sulfite reductase subunit S 478 651 YFR030W MET10 MET10 YPD SGD MIPS 5.63 1.64 3.04 3.04 1.84 1.12 1.44 0.70 viable New "Assimilatory sulfite reductase subunit, flavin-binding (alpha) subunit, part of the sulfate assimilation pathway " 1.647 -2.960 1 w 380 tctCGCGAAAtca 1 w 380 tctCGCGAAAtca unknown unknown G2/M 632 145 YFR039C YFR039C YFR039C YPD SGD MIPS 1.83 1.06 1.31 1.31 1.05 1.04 1.04 1.04 undocumented New Protein of unknown function 2.167 2.095 1 w 286 ATTACCAGCCCT H+ homeostasis plasma membrane H+-ATPase G2/M 704 201 YGL008C PMA1 PMA1 YPD SGD MIPS 1.70 3.57 2.47 0.41 2.35 3.43 2.84 2.84 lethal New see PMA2 4.135 1.611 DNA repair (putative) DNA damage-responsive protein G2/M 617 238 YGL021W ALK1 ALK1 YPD SGD MIPS 1.27 1.78 1.19 1.19 3.03 3.33 3.18 3.18 undocumented New DNA damage responsive protein; induced by mating pheromones 7.360 2.219 1 w 103 CCCTTTTTGGTAAAACGTAAACAA 1 w 103 CCCTTTTTGGTAAAACGTAAACAA cell wall biogenesis "beta-1,6-glucan assembly protein" G1 380 772 YGL027C CWH41 CWH41 YPD SGD MIPS 4.14 2.53 3.24 3.24 1.65 1.14 1.37 0.73 viable New "Type II integral N-glycoprotein of the endoplasmic reticulum involved in beta-1,6-glucase assembly" 2.428 -1.940 2 c107 ttaCGCGAAAatg c 106 attACGCGaaaat 1 c107 ttaCGCGAAAatg 1 c 106 attACGCGaaaat unknown unknown G1 144 288 YGL028C YGL028C YGL028C YPD SGD MIPS 1.16 2.04 1.54 1.54 2.11 1.12 1.37 0.73 undocumented New similarity to hypothetical proteins YGR279c and YMR305c 10.820 -0.687 1 c 592 taaACGCGagaaa 1 c 592 taaACGCGagaaa 2 w 616 AGAGCCAGCATT w 536 GAAACCAGCAAC 2 w 616 AGAGCCAGCATT w 536 GAAACCAGCAAC mating a-agglutinin binding subunit M/G1 52 55 YGL032C AGA2 AGA2 YPD SGD MIPS 3.74 2.13 2.82 0.35 1.09 1.58 1.31 1.31 undocumented New a-Agglutinin binding subunit 1.427 0.000 unknown unknown M/G1 74 332 YGL037C YGL037C YGL037C YPD SGD MIPS 1.09 1.02 1.03 1.03 1.12 1.18 1.15 0.87 undocumented New Protein of unknown function 1.893 -0.191 2 w 673 ATGGCCAGCACA w 673 ATGGCCAGCACA 1 c 289 accACGCGgcgcc 1 w 673 ATGGCCAGCACA 1 w 673 ATGGCCAGCACA protein glycosylation membrane-bound mannosyltransferase G1 167 456 YGL038C OCH1 OCH1 YPD SGD MIPS 2.65 1.55 2.03 2.03 2.37 1.02 1.55 0.64 viable New "Alpha-1,6-mannosyltransferase involved in initiation of mannose outer chain elongation of N-linked oligosaccharides of type Man[9]GlcNac[2]" 2.828 -0.810 2 w299 cacCGCGAAAaga w 269 taaACGCGccttt 1 w299 cacCGCGAAAaga 1 w 269 taaACGCGccttt unknown unknown M/G1 55 258 YGL055W OLE1 OLE1 YPD SGD MIPS 1.10 2.44 1.64 0.61 1.01 1.14 1.06 0.94 viable New "Stearoyl-CoA desaturase (delta-9 fatty acid desaturase), required for synthesis of unsaturated fatty acids " 7.478 -0.030 unknown unknown G1 361 399 YGL060W YGL060W YGL060W YPD SGD MIPS 1.44 1.17 1.30 1.30 1.50 1.09 1.28 0.78 undocumented New Protein of unknown function 2.261 -1.784 1 c 275 caaACGCGataaa 1 c 275 caaACGCGataaa unknown unknown G1 348 418 YGL061C DUO1 DUO1 YPD SGD MIPS 1.17 1.09 1.04 0.96 1.13 1.47 1.14 0.88 lethal New Protein that interacts with Dif1p and causes cell death upon overproduction 1.879 -1.671 1 w 93 caaACGCGataaa 1 w 93 caaACGCGataaa mating alpha factor G1 153 301 YGL089C mf(alpha)2 MF(ALPHA)2 YPD SGD MIPS 1.04 1.03 1.00 1.00 1.22 1.25 1.23 0.81 viable New Mating pheromone alpha-2 factor 3.969 -0.734 1 w 299 AATGCCAGCAAC DNA replication (putative) interacts with DNA ligase M/G1 103 300 YGL090W LIF1 LIF1 YPD SGD MIPS 1.12 1.10 1.11 0.90 1.69 1.18 1.41 0.71 viable New Protein that interacts with DNA ligase protein Dnl4 1.933 -0.478 1 C 323 GCTACCAGCAGA 1 C 323 GCTACCAGCAGA cytoskeleton spindle pole body component G1 388 798 YGL093W YGL093W SPC105 YPD SGD MIPS 1.82 2.85 2.28 2.28 1.59 1.28 1.43 0.70 undocumented New Protein of unknown function 2.211 -2.075 unknown unknown S/G2 541 682 YGL101W YGL101W YGL101W YPD SGD MIPS 1.35 1.13 1.24 1.24 1.13 1.14 1.13 0.88 undocumented New strong similarity to YBR242W 3.388 2.972 1 c 298 ACCACCAGCAGC mitosis activator of the anaphase promoting complex G2/M 717 233 YGL116W CDC20 CDC20 YPD SGD MIPS 1.71 1.19 1.42 0.70 2.55 3.81 3.12 3.12 lethal Known adaptor for APC 6.425 1.549 1 ATTTGATTGCCGAAAGAGGCAAAAC GTAAATAGGTTGT 1 ATTTGATTGCCGAAAGAGGCAAAAC GTAAATAGGTTGT methionine metabolism "methylenetetrahydrofolate reductase, putative" S 479 638 YGL125W MET11 MET13 YPD SGD MIPS 1.24 1.42 1.33 1.33 1.15 1.27 1.21 0.83 undocumented New Methylene tetrahydrofolate reductase - has similarity to Met12p 1.323 -2.960 2 c 106 ctaCACGAAAcac w 578 ttgACGCGatgc 1 c 106 ctaCACGAAAcac 1 w 578 ttgACGCGatgc transport hypoxic gene family (sterol uptake) G2/M 722 108 YGL162W SUT1 SUT1 YPD SGD MIPS 2.72 1.16 1.53 0.65 1.43 1.61 1.51 1.51 viable New Protein involved in sterol uptake 2.030 1.457 DNA repair DNA-dependent ATPase G1 253 391 YGL163C RAD54 RAD54 YPD SGD MIPS 1.23 1.01 1.11 1.11 1.33 1.49 1.41 0.71 viable Known "DNA-dependent ATPase of the Snf2p family, required for recombination and repair of X-ray damage " 2.879 -1.269 unknown similar to cystathionine beta-lyase S 438 643 YGL184C YGL184C YGL184C YPD SGD MIPS 1.58 2.15 1.84 1.84 1.40 1.09 1.13 0.88 undocumented New Protein with strong similarity to cystathionine beta-lyase 3.813 -2.542 2 w 518 ataCACGAAAgaa c 412 caaACGCGgactg 1 w 518 ataCACGAAAgaa 1 c 412 caaACGCGgactg unknown similar to D-2-hydroxyacid dehydrogenase G1 168 392 YGL185C YGL185C YGL185C YPD SGD MIPS 1.27 1.18 1.22 1.22 1.42 1.11 1.26 0.80 undocumented New Protein with similarity to D-2-hydroxyacid dehydrogenase 1.606 -0.822 1 w 141 cgcACGCGcgaag 1 w 141 cgcACGCGcgaag protein synthesis translational activator of GCN4 G1 306 614 YGL195W GCN1 GCN1 YPD SGD MIPS 1.23 2.24 1.35 1.35 1.55 1.20 1.14 0.88 viable New Component of a protein complex required for activation of Gcn2p protein kinase in response to starvation for amino acids or purines 1.584 -1.493 2 c420 tacCACGAAAtaa w 646 ctaACGCGagaag 1 c420 tacCACGAAAtaa 1 w 646 ctaACGCGagaag 1 c 212 ATTACCAGCTCG secretion vesicle coat component G1 399 757 YGL200C EMP24 EMP24 YPD SGD MIPS 1.69 1.39 1.53 1.53 1.82 1.03 1.33 0.75 viable New Component of the COPII coat of certain secretory pathway vesicles derived from the endoplasmic reticulum 1.740 -2.192 2 w92 tgaCACGAAActt w 157 aagACGCGaggaa 1 w92 tgaCACGAAActt 1 w 157 aagACGCGaggaa 1 w 674 ATCACCAGCAAA DNA replication MCM initiator complex G2/M 796 77 YGL201C MCM6 MCM6 YPD SGD MIPS 1.37 1.05 1.20 0.83 1.08 1.23 1.07 0.94 lethal New Member of the MCM/P1 family of proteins involved in DNA replication 2.848 0.628 1 c 346 aatCGCGAAAagg chromatin structure non-histone protein G1 196 549 YGL207W SPT16 SPT16 YPD SGD MIPS 1.72 2.23 1.96 1.96 1.84 1.45 1.63 0.61 lethal New aka CDC68; General chromatin factor required for adequate expression of CLN and other genes 2.553 -1.005 2 c36 gttCACGAAAggt c 206 atcACGCGacttc 1 c36 gttCACGAAAggt 1 c 206 atcACGCGacttc glucose repression transcriptional repressor G2/M 667 39 YGL209W MIG2 MIG2 YPD SGD MIPS 1.07 1.11 1.09 0.92 1.29 1.03 1.15 0.87 viable New Zinc-finger protein involved in glucose repression of SUC2 1.501 1.866 vacuole biogenesis unknown; regulator S/G2 544 368 YGL212W VAM7 VAM7 YPD SGD MIPS 1.29 1.16 1.23 1.23 1.29 1.20 1.04 0.97 viable New Protein involved in morphogenesis of the vacuole 1.447 2.948 1 w 612 GCAACCAGCCTA w 588 CCCAATGTAGAAAAGTACATCATATGAAACA mitosis kinesin related protein S/G2 498 745 YGL216W KIP3 KIP3 YPD SGD MIPS 1.01 1.41 1.18 1.18 2.11 1.36 1.24 0.80 undocumented New "Kinesin-related protein, involved in pre-anaphase nuclear migration" 3.063 -3.101 protein glycosylation S 426 769 YGL225W GOG5 GOG5 YPD SGD MIPS 5.47 3.09 4.11 4.11 1.35 1.85 1.58 0.63 lethal Known Golgi GDP-mannose transporter; vanadate-resistance protein required for normal Golgi functions including N-linked glycosylation 1.440 -2.442 3 c317 cggCACGAAAact c360 agcCGCGAAAata c 352 aaaACGCGagccg 1 c317 cggCACGAAAact 1 c360 agcCGCGAAAata 1 c 352 aaaACGCGagccg 3 w 403 CAGGCCAGCCCT c 448 GGCACCAGCTCG c 651 ATCACCAGCAAA transport high-affinity zinc transporter G2/M 665 146 YGL255W ZRT1 ZRT1 YPD SGD MIPS 1.24 1.37 1.30 1.30 1.16 1.69 1.21 0.83 viable New High-affinity zinc transport protein 2.751 1.876 bud emergence unknown G1 345 763 YGR014W MSB2 MSB2 YPD SGD MIPS 4.31 2.89 3.53 3.53 3.32 1.85 2.48 0.40 viable New Protein for which overproduction suppresses bud emergence defect of cdc24 mutant 2.458 -1.651 3 w469 agaCACGAAAaca c 513 gggACGCGcgcca c 648 ttcACGCGgatgt 1 w469 agaCACGAAAaca 2 c 513 gggACGCGcgcca c 648 ttcACGCGgatgt 2 c 68 GAAGCCAGCTAG c 674 TCCACCAGCTCG unknown unknown G2/M 627 168 YGR035C YGR035C YGR035C YPD SGD MIPS 1.25 1.08 1.16 0.86 1.42 1.54 1.48 0.68 undocumented New Protein of unknown function 3.874 2.121 "bud site selection, bipolar" unknown G1 161 565 YGR041W BUD9 BUD9 YPD SGD MIPS 1.27 1.46 1.36 1.36 1.36 1.28 1.32 0.76 viable New required for bud site selection but not for default mating 6.509 -0.778 1 c 185 TTACCCATTTAGGAAA c 368 AATTGCGCGGGG unknown unknown G1 164 295 YGR042W YGR042W YGR042W YPD SGD MIPS 1.51 1.27 1.09 1.09 1.16 1.30 1.06 0.94 undocumented New Protein of unknown function 2.350 -0.793 meiosis transcription factor G1 183 290 YGR044C RME1 RME1 YPD SGD MIPS 1.56 1.32 1.43 0.70 1.58 1.47 1.52 0.66 viable Known regulator of meiosis; transcriptional activator of CLN2 7.011 -0.949 1 c700 aaaCACGAAAttc 1 c700 aaaCACGAAAttc 2 w 338 TTTACCAGCAGA c 288 AAAGCCAGCAGA 1 c 288 AAAGCCAGCAGA transport methionine permease G1 411 654 YGR055W MUP1 MUP1 YPD SGD MIPS 2.25 1.25 1.68 1.68 1.55 1.01 1.25 0.80 viable New High-affinity methionine permease 2.227 -2.349 1 w 563 GCCACCAGCCGC unknown allantoate permease family G2/M 758 59 YGR065C YGR065C YGR065C YPD SGD MIPS 1.44 2.17 1.77 0.57 1.49 1.75 1.08 1.08 undocumented New Member of the allantoate permease family 1.362 1.098 1 c 547 CGAGCCAGCTGC unknown unknown M/G1 72 284 YGR086C YGR086C YGR086C YPD SGD MIPS 1.43 1.09 1.15 1.15 1.62 1.13 1.20 0.84 undocumented New strong similarity to hypothetical protein YPL004c 5.144 -0.171 1 c 515 gagACGCGcagta cell cycle late mitosis; protein kinase G2/M 760 86 YGR092W DBF2 DBF2 YPD SGD MIPS 1.89 1.39 1.62 0.62 1.37 1.81 1.58 1.58 viable Known "Serine/threonine protein kinase related to Dbf20p, required for events in anaphase/telophase" 6.256 1.088 telomere length regulation telomere binding protein S 460 741 YGR099W TEL2 TEL2 YPD SGD MIPS 1.76 1.20 1.45 1.45 1.70 1.17 1.20 0.83 lethal New Protein involved in controlling telomere length and telomere position effect 2.667 -2.718 cell cycle G2/M cyclin G2/M 657 241 YGR108W CLB1 CLB1 YPD SGD MIPS 4.03 1.51 2.47 2.47 7.19 3.15 4.76 4.76 viable Known B-type cyclin 8.779 1.919 1 TTACAACCGCCCAAAGAGGAAAAACATCAACAATCAAG 1 TTACAACCGCCCAAAGAGGAAAAACATCAACAATCAAG cell cycle B-type cyclin; S phase G1 176 500 YGR109C CLB6 CLB6 YPD SGD MIPS 2.89 5.33 3.92 3.92 1.16 1.11 1.14 0.88 viable Known B-type cyclin involved in S-phase initiation 7.086 -0.880 2 w168 attACGCGTcgc c 154 tttACGCGattcc 1 w168 attACGCGTcgc 1 c 154 tttACGCGattcc unknown unknown; interacts with Duo1p and Mps1p S 452 723 YGR113W DIF1 DAM1 YPD SGD MIPS 1.54 1.20 1.36 1.36 1.47 1.06 1.18 0.85 lethal New Duo1p-interacting factor 1.849 -2.629 2 c 173 gcaACGCGcaatg c 326 attACGCGcttct 2 c 173 gcaACGCGcaatg c 326 attACGCGcttct asparagine biosynthesis asparagine synthetase S/G2 503 634 YGR124W ASN2 ASN2 YPD SGD MIPS 1.63 1.27 1.13 1.13 1.14 1.05 1.04 0.96 viable New "Asparagine synthetase (L-aspartate: L-glutamine amidoligase [AMP-forming]), Asn1p and Asn2p are isozymes " 6.280 3.142 unknown major facilitator superfamily S/G2 591 625 YGR138C YGR138C YGR138C YPD SGD MIPS 2.63 1.32 1.41 1.41 1.25 1.61 1.14 0.88 undocumented New Member of major facilitator superfamily (MFS) multidrug-resistance proteins family 1 2.925 2.436 2 w 656 ctgACGCGTgcg c 520 gcgACGCGacagt 1 w 656 ctgACGCGTgcg 1 c 520 gcgACGCGacagt mitosis "kinetochore protein complex CBF3, 110 KD subunit" G1 409 726 YGR140W CBF2 CBF2 YPD SGD MIPS 2.28 1.38 1.77 1.77 1.50 1.61 1.56 0.64 lethal New Component (subunit a) of Cbf3 kinetochore complex 2.327 -2.321 3 c615 aggCACGAAAata c69 aaaCGCGAAAggt c 68 aaaACGCGaaagg 1 c615 aggCACGAAAata 1 c69 aaaCGCGAAAggt 1 c 68 aaaACGCGaaagg cell wall biogenesis (1->6)-beta-glucan synthase subunit G2/M 738 82 YGR143W SKN1 SKN1 YPD SGD MIPS 1.93 1.33 1.60 0.62 2.66 2.53 2.59 2.59 viable New "Glucan synthase subunit involved in synthesis of beta-1,6-glucan " 5.617 1.341 1 w 615 CCCAAAGCGGAAAATTGGTCAACAT 1 w 615 CCCAAAGCGGAAAATTGGTCAACAT 1 c 175 TCTACCAGCTGC unknown unknown G2/M 759 2 YGR146C YGR146C YGR146C YPD SGD MIPS 1.93 1.85 1.89 0.53 1.05 1.01 1.02 1.02 undocumented New Protein of unknown function 1.495 1.091 unknown unknown G1 248 530 YGR151C YGR151C YGR151C YPD SGD MIPS 2.39 1.88 2.12 2.12 2.32 1.52 1.87 0.53 undocumented New novel; questionable ORF 4.730 -1.257 1 c 186 ggaACGCGatcgg 1 c 186 ggaACGCGatcgg 1 c 475 ACCACCAGCACC c 215 TATAATGCGGGG bud site selection "GTP-binding protein, ras superfamily" G1 236 529 YGR152C RSR1 RSR1 YPD SGD MIPS 4.74 2.03 3.10 3.10 1.95 1.72 1.83 0.55 viable New GTP-binding protein of the ras superfamily involved in bud site selection 5.978 -1.211 2 w152 aaaCGCGAAAact w 153 aaaACGCGaaaac 1 w152 aaaCGCGAAAact 1 w 153 aaaACGCGaaaac unknown unknown G1 283 404 YGR153W YGR153W YGR153W YPD SGD MIPS 2.07 1.11 1.37 1.37 1.94 1.47 1.69 0.59 undocumented New Protein of unknown function 1.434 -1.386 3 c352 aaaCGCGAAAtat w 315 ttgACGCGaatta c 351 caaACGCGaaata 1 c352 aaaCGCGAAAtat 2 w 315 ttgACGCGaatta c 351 caaACGCGaaata 1 w 638 ACCACCAGCACC unknown unknown G2/M 688 102 YGR176W YGR176W YGR176W YPD SGD MIPS 2.30 1.47 1.84 0.54 1.29 1.32 1.01 1.01 undocumented New novel; questionable ORF 2.530 1.701 1 w 380 AACACCAGCACC acetate ester biosynthesis alcohol acetyltransferase G2/M 694 101 YGR177C ATF2 ATF2 YPD SGD MIPS 1.96 2.38 2.16 0.46 1.07 1.11 1.09 0.92 undocumented New Alcohol O-acetyltransferase 3.141 1.681 "cell cycle, checkpoint" protein kinase G1 370 425 YGR188C BUB1 BUB1 YPD SGD MIPS 1.43 1.59 1.51 1.51 1.64 1.64 1.64 0.61 undocumented New Serine/threonine protein kinase and checkpoint protein required for cell cycle arrest in response to loss of microtubule function 3.273 -1.877 1 w 146 gatACGCGctagg 1 w 146 gatACGCGctagg 1 c 251 AAAACCAGCTAT unknown unknown G1 270 754 YGR189C YGR189C YGR189C YPD SGD MIPS 5.94 1.43 2.91 2.91 4.65 4.00 4.31 0.23 viable New similarity to Utr2p 8.290 -1.344 3 c313 tacCACGAAAagc w422 atgACGCGTttt c 466 ttcACGCGgttcg 1 c313 tacCACGAAAagc 1 w422 atgACGCGTttt 1 c 466 ttcACGCGgttcg 1 c 156 CTAACCAGCAAG 1 c 156 CTAACCAGCAAG unknown unknown M/G1 79 324 YGR219W YGR219W YGR219W YPD SGD MIPS 1.18 1.41 1.29 0.78 1.53 1.08 1.28 0.78 undocumented New Protein of unknown function 1.405 -0.243 unknown unknown G1 264 525 YGR221C YGR221C YGR221C YPD SGD MIPS 2.31 2.18 2.25 2.25 1.57 1.23 1.39 0.72 undocumented New has similarity to YHR149C and FLO11 6.070 -1.311 4 w274 agtCGCGAAAaaa c242 gaaCGCGAAActt c 180 tttACGCGactgg c 241 cgaACGCGaaact 2 w274 agtCGCGAAAaaa c242 gaaCGCGAAActt 2 c 180 tttACGCGactgg c 241 cgaACGCGaaact unknown similar to Spo12p G2/M 799 85 YGR230W YGR230W YGR230W YPD SGD MIPS 1.81 1.43 1.61 0.62 1.76 1.36 1.55 1.55 undocumented New Protein with similarity to Spo12p 3.674 0.579 oxidative stress response (putative) flavohemoglobin M/G1 83 264 YGR234W YHB1 YHB1 YPD SGD MIPS 2.31 2.04 2.17 0.46 1.18 1.43 1.10 0.91 viable New "Flavohemoglobin of unknown function, distantly related to animal hemoglobins " 1.972 -0.253 2 w 573 AGTACCAGCAAA C 301 AGTGCCAGCAAA 1 w 385 cggACGCGcttat 2 w 573 AGTACCAGCAAA C 301 AGTGCCAGCAAA unknown similar to Kel1p and Kel3p G1 203 427 YGR238C KEL2 KEL2 YPD SGD MIPS 1.63 1.31 1.46 1.46 1.11 1.14 1.12 0.89 undocumented New Protein with similarity to Kel1p and Kel3p 1.683 -1.060 1 w271 ctgCACGAAAtga 1 w271 ctgCACGAAAtga glycolysis phosphofructokinase G2/M 646 153 YGR240C PFK1 PFK1 YPD SGD MIPS 1.01 1.15 1.07 1.07 1.40 1.08 1.14 0.88 viable New "Phosphofructokinase alpha subunit, part of a complex with Pfk2p which carries out a key regulatory step in glycolysis " 1.619 1.983 unknown unknown G2/M 692 9 YGR259C YGR259C YGR259C YPD SGD MIPS 1.45 2.00 1.71 0.59 1.70 1.19 1.20 0.84 undocumented New Protein of unknown function 1.323 1.691 unknown similar to Dal5p G2/M 727 10 YGR260W YGR260W YGR260W YPD SGD MIPS 1.13 1.69 1.38 0.72 1.04 1.05 1.05 0.95 undocumented New Protein with similarity to Dal5p 1.433 1.427 DNA replication (putative) ribonuclease H M/G1 69 294 YGR276C RNH70 RNH70 YPD SGD MIPS 1.23 1.16 1.03 1.03 1.14 1.33 1.23 0.81 undocumented New RNase H 1.768 -0.151 unknown unknown G2/M 640 198 YGR279C YGR279C YGR279C YPD SGD MIPS 2.35 4.00 3.06 0.33 1.44 3.05 2.10 2.10 undocumented New Protein of unknown function 2.662 2.028 1 c 436 tcgCGCGAAAagc 2 w 392 aacACGCGcaacg w 319 ttcACGCGcattt unknown similar to mouse Surf-4 protein PIR:A34727 G2/M 742 45 YGR284C YGR284C YGR284C YPD SGD MIPS 1.23 1.25 1.24 0.81 1.36 1.35 1.00 1.00 undocumented New Protein with similarity to mouse Surf-4 protein PIR:A34727 1.850 1.290 1 c 354 GGCACCAGCAGC w 586 TATTCGGCGGGG unknown similar to other subtelomerically-encoded proteins G1 150 591 YGR296W YGR296W YGR296W YPD SGD MIPS 1.06 1.89 1.42 1.42 1.53 1.23 1.12 0.90 undocumented New Protein with similarity to other subtelomerically-encoded protein (YPL283 and YGR296W code for identical proteins) 3.643 -0.722 1 w 255 ctgACGCGccata 1 w 255 ctgACGCGccata unknown unknown G2/M 756 65 YHL026C YHL026C YHL026C YPD SGD MIPS 1.04 1.89 1.40 0.71 2.55 1.34 1.85 1.85 undocumented New "Protein of unknown function, has potential signal sequence and 2 potential transmembrane domains " 4.457 1.105 1 c 688 cacACGCGgaaaa 1 w 129 AGAGCCAGCGCC 1 w 129 AGAGCCAGCGCC cell wall integrity and stress response unknown G2/M 634 180 YHL028W WSC4 WSC4 YPD SGD MIPS 1.09 1.18 1.04 1.04 1.71 1.06 1.27 1.27 viable New "cell Wall integrity and Stress response Component; has similarity to Slg1p, Wsc2p, and Wsc3p" 9.908 2.073 unknown similar to subtelomerically-encoded proteins G2/M 735 100 YHL040C YHL040C YHL040C YPD SGD MIPS 1.66 1.40 1.52 0.66 1.39 1.07 1.14 0.88 undocumented New Member of major facilitator superfamily (MFS) multidrug-resistance (MFS-MDR) protein family 1.984 1.378 unknown similar to other subtelomerically-encoded proteins G1 129 574 YHL049C YHL049C YHL049C YPD SGD MIPS 1.98 2.14 1.04 1.04 1.98 1.45 1.17 0.86 undocumented New Protein with similarity to other subtelomerically-encoded proteins 4.874 -0.597 unknown similar to other subtelomerically-encoded proteins G1 121 589 YHL050C YHL050C YHL050C YPD SGD MIPS 2.34 2.65 2.49 2.49 1.32 1.20 1.26 0.79 undocumented New Protein with similarity to other subtelomerically-encoded proteins 3.155 -0.550 2 w125 taaCGCGAAAaag w 126 gtaACGCGaaaaa 1 w125 taaCGCGAAAaag 1 w 126 gtaACGCGaaaaa "signaling, pheromone pathway" alpha subunit of G protein coupled to mating factor M/G1 10 75 YHR005C GPA1 GPA1 YPD SGD MIPS 1.51 1.89 1.69 0.59 1.84 1.70 1.04 0.96 lethal New Guanine nucleotide-binding protein alpha subunit of the pheromone response pathway 6.566 0.386 1 c 251 TTTCCCTTTAAGGAAA 1 c 330 aggACGCGcagag tRNA splicing unknown S/G2 530 367 YHR006W STP2 STP2 YPD SGD MIPS 1.20 1.04 1.07 0.93 1.48 1.01 1.22 0.82 undocumented New Protein involved in tRNA splicing and branched-chain amino acid uptake 1.446 3.049 1 w 660 AATACCAGCACT unknown similar to N-terminal region of ras-related M/G1 13 28 YHR022C YHR022C YHR022C YPD SGD MIPS 1.35 1.27 1.03 0.97 1.01 1.14 1.06 0.94 undocumented New Protein with weak similarity to N-terminal region of ras-related proteins 1.321 0.360 c 495 AATGTTGTGGGG cell wall biosynthesis myosin heavy chain G2/M 653 225 YHR023W MYO1 MYO1 YPD SGD MIPS 1.49 1.23 1.10 0.91 1.44 2.39 1.29 1.29 viable New mutants probably fail in septation because Chs2p required for septum formation is not transported to the proper site 5.613 1.951 1 w 188 CCCAAAAGGGTAATTGCGTAAACAT 1 w 188 CCCAAAAGGGTAATTGCGTAAACAT 1 w 122 ATGACCAGCTAC unknown similar to thymidylate synthase in the N-terminal G2/M 675 129 YHR029C YHR029C YHR029C YPD SGD MIPS 1.80 1.05 1.38 0.73 1.11 1.18 1.14 0.88 undocumented New Protein with similarity to thymidylate synthase in the N-terminal region 1.574 1.824 "signaling, PKC1 pathway" MAP kinase (mitogen-activated protein kinase) S 444 356 YHR030C SLT2 SLT2 YPD SGD MIPS 2.39 1.13 1.46 1.46 1.75 1.66 1.71 0.59 viable New Serine/threonine protein kinase of MAP kinase family involved in the cell wall integrity (low-osmolarity) pathway 1.639 -2.579 bud emergence binds Cdc42p S 454 740 YHR061C GIC1 GIC1 YPD SGD MIPS 1.50 1.73 1.61 1.61 1.84 1.39 1.60 0.63 viable New "Putative effector of Cdc42p, important for bud emergence" 5.193 -2.660 2 w 294 attCGCGAAAaga w 303 gcgACGCGaattc 1 w 294 attCGCGAAAaga 1 w 303 gcgACGCGaattc unknown unknown G1 125 373 YHR067W YHR067W YHR067W YPD SGD MIPS 1.14 1.05 1.10 0.91 1.41 1.20 1.30 0.77 undocumented New Protein of unknown function 1.386 -0.585 1 c 57 TGTACCAGCCAC "RNA splicing, mitochondrial" RNA binding protein S/G2 493 694 YHR086W NAM8 NAM8 YPD SGD MIPS 1.42 1.20 1.31 1.31 1.15 1.06 1.10 0.91 viable New "U1 snRNA-associated protein, essential for meiotic recombination and suppressor of mitochondrial splicing defects, has 3 RNA recognition (RRM) domains " 3.086 -3.021 transport hexose permease M/G1 3 13 YHR092C HXT4 HXT4 YPD SGD MIPS 2.51 1.06 1.63 0.61 1.93 1.59 1.75 0.57 viable New "Moderate- to low-affinity hexose transporter, member of sugar permease family " 1.431 0.534 transport hexose permease M/G1 107 18 YHR094C HXT1 HXT1 YPD SGD MIPS 2.46 1.05 1.61 0.62 1.56 1.10 1.31 0.76 viable New "Low-affinity hexose transporter and member of sugar permease family, induced by glucose only at high concentration " 1.863 -0.491 unknown unknown; binds Sed3p and Sec23p S 463 778 YHR098C YHR098C SFB3 YPD SGD MIPS 2.07 1.79 1.93 1.93 1.42 1.09 1.24 0.80 viable New similarity to human hypothetical protein 1.575 -2.791 2 c 503 acgCACGAAAata c 419 gacACGCGcattt 1 c 503 acgCACGAAAata 1 c 419 gacACGCGcattt pyrimidine biosynthesis thioredoxin reductase G1 239 349 YHR106W TRR2 TRR2 YPD SGD MIPS 1.06 1.17 1.05 1.05 1.20 1.04 1.08 0.93 viable New Thioredoxin reductase 1.701 -1.224 1 c 129 acaACGCGcccga 1 c 129 acaACGCGcccga 1 c 314 TTTGCCAGCCAG unknown unknown S/G2 536 784 YHR108W YHR108W YHR108W YPD SGD MIPS 3.69 1.80 2.58 2.58 1.06 1.06 1.00 1.00 undocumented New strong similarity to hypothetical protein YDR358w 1.440 3.022 1 w 550 ttaACGCGTaat 1 w 550 ttaACGCGTaat 1 c 339 CCAACCAGCGTT 1 c 339 CCAACCAGCGTT membrane trafficking; secretion (putative) unknown G1 307 488 YHR110W YHR110W ERP5 YPD SGD MIPS 1.99 1.38 1.66 1.66 1.48 1.33 1.41 0.71 undocumented New related to component of the COPII coat of certain ER-derived vesicles 5.152 -1.502 2 w135 ctgACGCGTttt c 112 aaaACGCGagaaa 1 w135 ctgACGCGTttt 1 c 112 aaaACGCGagaaa 1 w 486 TATACCAGCAGG unknown similar to vacuolar aminopeptidase Lap4p/Ape1p G1 140 323 YHR113W YHR113W YHR113W YPD SGD MIPS 1.60 1.22 1.14 1.14 1.37 1.25 1.05 0.95 undocumented New Protein with similarity to vacuolar aminopeptidase Lap4p/Ape1p 1.760 -0.661 2 c664 ttgCACGAAAaga c 573 aacACGCGatata 1 c664 ttgCACGAAAaga 1 c 573 aacACGCGatata phospholipid metabolism "sn-1,2-diacylglycerol ethanolamine- and cholinephosphotranferase" G1 228 405 YHR123W EPT1 EPT1 YPD SGD MIPS 1.37 1.03 1.15 1.15 1.40 1.12 1.25 0.80 viable New "sn-1,2-Diacylglycerol ethanolaminephosphotransferase " 1.641 -1.169 1 w 137 tttACGCGaggaa 1 w 137 tttACGCGaggaa unknown similar to members of the Pir1p/Hsp150p/Pir3p M/G1 1 52 YHR126C YHR126C YHR126C YPD SGD MIPS 1.86 1.28 1.54 0.65 1.17 1.19 1.18 0.85 undocumented New Protein with similarity to members of the Pir1p/Hsp150p/Pir3p family 2.224 0.554 1 c 609 caaCGCGAAAaaa 1 c 608 ccaACGCGaaaaa unknown suppresses SEC4 dominant negative mutant G1 290 607 YHR127W HSN1 HSN1 YPD SGD MIPS 1.81 1.81 1.81 1.81 1.58 1.03 1.28 0.78 viable New High-copy allele-specific suppressor SEC4 1.446 -1.420 2 w135 caaCGCGAAAaaa w 136 ccaACGCGaaaaa 1 w135 caaCGCGAAAaaa 1 w 136 ccaACGCGaaaaa unknown protein kinase S/G2 545 669 YHR135C YCK1 YCK1 YPD SGD MIPS 1.94 1.36 1.62 1.62 1.92 1.08 1.33 0.75 viable New Casein kinase I isoform 2.263 2.945 1 c 45 atgCGCGAAAttt 1 c 45 atgCGCGAAAttt 2 w 642 GTCACCAGCATA c 33 AGGGCCAGCGAA 1 c 33 AGGGCCAGCGAA aromatic amino acod metabolism aromatic amino acid aminotransferase II G2/M 631 121 YHR137W ARO9 ARO9 YPD SGD MIPS 1.60 1.33 1.46 0.68 1.60 1.45 1.05 0.95 viable New Aromatic amino acid aminotransferase II 2.152 2.107 unknown unknown G1 287 286 YHR143W RPC10 YHR143W YPD SGD MIPS 1.04 1.37 1.15 0.87 1.16 1.20 1.18 0.85 lethal New "Shared subunit of RNA polymerases I, II, and III (ABC10alpha), has zinc-binding domain " 9.329 -1.404 3 w 424 AGAACCAGCAAT w 265 TAAACCAGCAAT c 642 GAGACCAGCGGA 3 w 424 AGAACCAGCAAT w 265 TAAACCAGCAAT c 642 GAGACCAGCGGA unknown similar to pheromone adaptation protein Mdg1p S/G2 537 244 YHR146W YHR146W YHR146W YPD SGD MIPS 2.97 1.11 1.64 1.64 1.61 1.10 1.33 0.75 undocumented New Protein with similarity to pheromone adaptation protein Mdg1p 1.783 3.018 unknown unknown G1 155 473 YHR149C YHR149C YHR149C YPD SGD MIPS 2.16 1.01 1.46 1.46 1.97 1.43 1.68 0.60 undocumented New similar to YGR221C 2.344 -0.753 1 c292 cttCGCGAAAaaa 1 c292 cttCGCGAAAaaa 1 c 609 GAGACCAGCTCA unknown unknown G2/M 741 161 YHR151C YHR151C YHR151C YPD SGD MIPS 1.83 1.11 1.42 1.42 2.49 1.22 1.43 1.43 undocumented New novel 2.841 1.303 1 c 110 AATACCAGCAAA meiosis unknown G2/M 729 87 YHR152W SPO12 SPO12 YPD SGD MIPS 2.78 2.78 2.78 0.36 2.58 4.96 3.58 3.58 viable Known "involved in meiosis, and exit from mitosis" 2.075 1.423 1 c 561 ATTACCAGCAGA "meiosis, spore formation" unknown G1 277 524 YHR153C SPO16 SPO16 YPD SGD MIPS 1.96 2.25 2.10 2.10 1.12 1.12 1.00 1.00 undocumented New Early meiotic protein required for efficient spore formation 3.278 -1.365 3 w168 tgaCGCGAAAaac w105 ttaACGCGTgaa w 169 gtgACGCGaaaaa 1 w168 tgaCGCGAAAaac 1 w105 ttaACGCGTgaa 1 w 169 gtgACGCGaaaaa silencing unknown G1 364 437 YHR154W ESC4 ESC4 YPD SGD MIPS 4.69 3.43 4.01 4.01 3.43 1.28 2.10 0.48 undocumented New Protein involved in chromatin silencing 1.642 -1.816 4 c128 tgaCGCGAAAaac w190 ttcACGCGTtaa c 127 gtgACGCGaaaaa c 545 ttcACGCGcttga 1 c128 tgaCGCGAAAaac 1 w190 ttcACGCGTtaa 2 c 127 gtgACGCGaaaaa c 545 ttcACGCGcttga unknown unknown G1 279 410 YHR159W YHR159W YHR159W YPD SGD MIPS 1.61 1.96 1.78 1.78 1.13 1.20 1.03 0.97 undocumented New Protein of unknown function 2.059 -1.375 2 c 148 atcACGCGgcacg c 176 gcgACGCGgttgt 2 c 148 atcACGCGgcacg c 176 gcgACGCGgttgt cytoskeleton spindle pole body component G1 384 728 YHR172W SPC97 SPC97 YPD SGD MIPS 1.09 1.07 1.01 1.01 1.45 1.03 1.22 0.82 lethal New Spindle pole body component that plays a role in organization of nuclear and cytoplasmic microtubules 1.477 -1.985 unknown unknown G1 374 765 YHR173C YHR173C YHR173C YPD SGD MIPS 1.70 1.50 1.60 1.60 1.45 1.33 1.39 0.72 undocumented New novel 1.771 -1.908 1 w 662 ACCACCAGCGTG transcription unknown; binds Sin3p S/G2 524 695 YHR178W STB5 STB5 YPD SGD MIPS 1.60 1.32 1.45 1.45 1.31 1.10 1.09 0.91 lethal New "Protein with similarity to transcription factors, has Zn[2]-Cys[6] fungal-type binuclear cluster domain in the N-terminal region " 1.352 3.076 1 c 492 ATTACCAGCATT signaling protein kinase G2/M 610 626 YHR205W SCH9 SCH9 YPD SGD MIPS 1.17 1.15 1.16 1.16 1.31 1.02 1.13 0.88 lethal New Serine/threonine protein kinase that is activated by cAMP 1.508 2.293 1 c 197 gacCACGAAAagg 1 c 343 GCGACCAGCGAA 1 c 343 GCGACCAGCGAA c 60 TTTAAGGTGGGG branched chain amino acid degradation transaminase S/G2 508 633 YHR208W BAT1 BAT1 YPD SGD MIPS 1.40 1.69 1.10 0.91 2.07 1.41 1.71 0.59 viable New Mitochondrial branched-chain amino acid transaminase 3.460 3.135 1 c 322 tacACGCGgtact 1 c 322 tacACGCGgtact phosphate metabolism secreted acid phosphatase G2/M 750 93 YHR215W PHO12 PHO12 YPD SGD MIPS 1.51 1.75 1.63 0.62 4.94 2.16 3.27 3.27 viable New "Acid phosphatase, secreted (PHO11 and PHO12 code for nearly identical proteins)" 5.297 1.213 unknown similar to other subtelomerically-encoded proteins G1 133 579 YHR218W YHR218W YHR218W YPD SGD MIPS 1.70 2.20 1.94 1.94 1.43 1.42 1.00 1.00 undocumented New Protein with similarity to other subtelomerically-encoded proteins 4.986 -0.622 unknown similar to other subtelomerically-encoded proteins M/G1 108 586 YHR219W YHR219W YHR219W YPD SGD MIPS 2.03 1.91 1.97 1.97 1.14 1.09 1.11 0.90 undocumented New Protein with similarity to other subtelomerically-encoded proteins 2.481 -0.492 1 w 14 ggtACGCGagttc fatty acid metabolism acyl CoA synthase M/G1 48 274 YIL009W FAA3 FAA3 YPD SGD MIPS 1.82 2.50 2.13 0.47 1.20 1.17 1.01 0.99 viable New "Acyl-CoA synthase (long-chain fatty acid CoA ligase), activates endogenous but not imported fatty acids " 6.035 0.037 1 w 479 GATACCAGCAGT 1 w 479 GATACCAGCAGT w 555 CTAATCGTGGGG unknown "similar to Yil176p, Yir041p and other members of" G2/M 614 144 YIL011W YIL011W YIL011W YPD SGD MIPS 1.02 1.16 1.09 0.92 2.03 1.27 1.60 0.62 undocumented New "Protein with similarity to Yil176p, Yir041p and other members of the PAU1 family" 1.603 2.253 1 c 70 ACAACCAGCAAG 1 c 70 ACAACCAGCAAG 1 c 258 TTTCCCAAAAAGGAAA unknown unknown G1 332 420 YIL025C YIL025C YIL025C YPD SGD MIPS 1.10 1.18 1.03 1.03 1.14 1.04 1.09 1.09 undocumented New Protein of unknown function 1.980 -1.591 unknown colony morphology G1 245 426 YIL026C IRR1 IRR1 YPD SGD MIPS 1.17 1.24 1.20 1.20 1.56 1.45 1.51 0.66 lethal New Protein involved in colony morphology and adhesion to solid supports 2.887 -1.247 3 c538 ttcCACGAAAtga w138 gcgACGCGTgac w 143 gcaACGCGACGCG 1 c538 ttcCACGAAAtga 1 w138 gcgACGCGTgac 1 w 143 gcaACGCGACGCG cell cycle cyclin S/G2 552 690 YIL050W PCL7 PCL7 YPD SGD MIPS 1.08 1.09 1.00 1.00 1.47 1.43 1.45 0.69 undocumented New "Cyclin, associates with Pho85p " 2.186 2.841 unknown unknown G2/M 648 42 YIL056W YIL056W YIL056W YPD SGD MIPS 1.50 1.00 1.22 1.22 1.04 1.03 1.03 0.97 undocumented New Protein of unknown function 2.363 1.973 DNA repair repair-induced ribonucleotide reductase G1 244 477 YIL066C RNR3 RNR3 YPD SGD MIPS 2.28 3.00 2.61 2.61 2.94 1.59 2.16 0.46 viable New Ribonucleotide reductase; transcription is tightly cell cycle regulated and moderately inducible by DNA damage 7.525 -1.244 5 c153 gaaCACGAAAcaa c178 tgaCACGAAAaac c330 aacCACGAAAaaa w549 cgcACGCGTaaa w190 ctgACGCGTttc 3 c153 gaaCACGAAAcaa c178 tgaCACGAAAaac c330 aacCACGAAAaaa 2 w549 cgcACGCGTaaa w190 ctgACGCGTttc "meiosis, synapsis" DNA binding protein S/G2 557 36 YIL072W HOP1 HOP1 YPD SGD MIPS 1.36 1.49 1.05 1.05 1.52 1.41 1.47 0.68 viable New "Meiosis-specific protein associated with lateral elements of the synaptonemal complex, involved in homologous chromosome synapsis and chiasmata formation " 10.360 2.797 1 c 415 TGGACCAGCGGC 1 c 415 TGGACCAGCGGC unknown putative alpha-ketoisocaproate reductase S 434 646 YIL074C YIL074C YIL074C YPD SGD MIPS undocumented New Potential alpha-ketoisocaproate reductase 1.574 -2.506 secretion vesicle coat component G1 355 387 YIL076W SEC28 SEC28 YPD SGD MIPS 1.37 1.08 1.22 1.22 1.58 1.85 1.71 0.59 viable New "Coatamer complex epsilon chain (epsilon-COP) of secretory pathway vesicles, required for retrograde transport from Golgi to endoplasmic reticulum " 1.353 -1.711 1 c 225 TTCACCAGCTTG lysine biosynthesis homo-isocitrate dehydrogenase G2/M 624 105 YIL094C LYS12 LYS12 YPD SGD MIPS 1.42 1.79 1.59 0.63 1.65 1.08 1.23 0.81 viable New "Homoisocitrate dehyrogenase, fourth step in lysine biosynthesis pathway, converts homoisocitrate to alpha-ketoadipate " 1.536 2.154 unknown unknown G1 240 364 YIL104C YIL104C YIL104C YPD SGD MIPS 1.23 1.11 1.17 0.86 1.83 1.14 1.27 0.79 undocumented New Protein of unknown function 1.914 -1.237 mitosis unknown; binds Mps1p and Dbf2p G2/M 664 230 YIL106W MOB1 MOB1 YPD SGD MIPS 1.64 1.41 1.52 0.66 1.05 2.07 1.47 1.47 lethal Known Mps one binder 4.663 1.876 w 343 TGTATGCTGGGG mitochondrial transport "porin, anion channel" M/G1 94 20 YIL114C POR2 POR2 YPD SGD MIPS 1.67 1.37 1.51 0.66 1.34 1.11 1.10 0.91 viable New Outer mitochondrial membrane porin (voltage-dependent anion-selective channel) 1.509 -0.379 2 w 653 GTGGCCAGCATA w 653 GTGGCCAGCATA 1 c 601 cccACGCGaacac 1 w 653 GTGGCCAGCATA 1 w 653 GTGGCCAGCATA unknown unknown S 415 358 YIL117C YIL117C YIL117C YPD SGD MIPS 1.44 1.27 1.06 0.94 1.81 1.60 1.70 0.59 undocumented New Protein of unknown function 1.527 -2.377 "signaling, Ras pathway" negative regulator of ras-cAMP pathway G2/M 705 106 YIL119C RPI1 RPI1 YPD SGD MIPS 2.76 1.03 1.69 0.59 1.71 1.12 1.24 1.24 viable New "Negative regulator of ras-cAMP pathway, downregulates normal but not mutant ras function " 2.621 1.601 unknown major facilitator superfamily G2/M 776 159 YIL121W YIL121W YIL121W YPD SGD MIPS 1.13 1.19 1.16 0.86 1.02 1.28 1.12 0.89 undocumented New Member of major facilitator superfamily (MFS) multidrug-resistance (MFS-MDR) protein family 1.315 0.893 1 c 52 ATGACCAGCAAC 1 c 52 ATGACCAGCAAC w 615 TATTCGGCGGGG unknown unknown G2/M 663 188 YIL122W YIL122W YIL122W YPD SGD MIPS 1.01 1.01 1.00 1.00 1.09 1.10 1.00 1.00 undocumented New Protein of unknown function 1.934 1.886 2 c 163 aatACGCGaacct c 187 agtACGCGatttg cell cycle unknown S/G2 525 716 YIL123W SIM1 SIM1 YPD SGD MIPS 4.51 2.33 3.24 3.24 2.03 2.00 2.02 0.50 undocumented New Protein involved in the aging process and in regulation of the cell cycle; has 71% identity to Sun4p over 359 amino acids 3.317 3.075 3 w 300 cgtCACGAAAatt c 229 tgaCGCGAAAcgc c 228 ctgACGCGaaacg 1 w 300 cgtCACGAAAatt 1 c 229 tgaCGCGAAAcgc 1 c 228 ctgACGCGaaacg unknown unknown S/G2 515 713 YIL129C YIL129C YIL129C YPD SGD MIPS 1.24 1.60 1.13 1.13 1.52 1.24 1.11 0.90 undocumented New similarity to hypothetical human protein 5.001 3.119 1 w 197 aacCACGAAAcga 1 w 197 aacCACGAAAcga unknown similar to Drosophila fork head protein S/G2 540 700 YIL131C FKH1 FKH1 YPD SGD MIPS 2.09 1.33 1.67 1.67 1.78 1.05 1.37 1.37 viable New contains a forkhead-associated (FHA) domain 3.345 2.977 w 256 ATGAAGGTGGGG unknown unknown G1 315 424 YIL132C YIL132C YIL132C YPD SGD MIPS 1.22 1.41 1.31 1.31 1.31 1.01 1.15 0.87 undocumented New novel 2.132 -1.523 2 w106 aaaCGCGAAAgct w 107 caaACGCGaaagc 1 w106 aaaCGCGAAAgct 1 w 107 caaACGCGaaagc 2 c 561 TTTACCAGCATT c 636 TTGACCAGCTCT unknown unknown S/G2 505 691 YIL135C YIL135C YIL135C YPD SGD MIPS 1.45 1.14 1.28 1.28 1.13 1.12 1.13 0.89 undocumented New Protein of unknown function 1.530 3.142 cytoskeleton tropomyosin S/G2 582 369 YIL138C TPM2 TPM2 YPD SGD MIPS 1.20 1.47 1.11 0.90 1.06 1.13 1.03 1.03 viable New "Tropomyosin isoform 2, coiled-coil protein " 1.840 2.486 "bud site selection, axial" plasma membrane protein G1 330 534 YIL140W SRO4 SRO4 YPD SGD MIPS 8.03 3.06 4.96 4.96 8.53 4.35 6.09 0.16 viable New "aka AXL2/BUD10; Membrane glycoprotein localized at site of bud emergence, required for axial budding" 9.661 -1.581 4 w386 agaCGCGAAAaaa w368 acaACGCGTcat w 387 aagACGCGaaaaa c 345 gtgACGCGaattg 1 w386 agaCGCGAAAaaa 1 w368 acaACGCGTcat 2 w 387 aagACGCGaaaaa c 345 gtgACGCGaattg c 262 AAGATGGTGGGG unknown unknown G1 301 483 YIL141W YIL141W YIL141W YPD SGD MIPS 1.16 1.63 1.19 1.19 2.66 1.72 2.14 0.47 undocumented New novel; questionable ORF 6.591 -1.459 4 w73 agaCGCGAAAaaa w55 acaACGCGTcat w 74 aagACGCGaaaaa c 32 gtgACGCGaattg 1 w73 agaCGCGAAAaaa 1 w55 acaACGCGTcat 2 w 74 aagACGCGaaaaa c 32 gtgACGCGaattg 2 c 413 AAAACCAGCATT c 674 TTCACCAGCTTT 1 c 413 AAAACCAGCATT unknown unknown S 422 720 YIL144W TID3 TID3 YPD SGD MIPS 1.87 1.15 1.28 1.28 1.17 1.14 1.15 0.87 lethal New "Protein with similarity to myosin heavy chain, possible coiled-coil " 1.650 -2.413 1 c 331 TCAACCAGCCCA unknown similar to Ykr100p G2/M 607 227 YIL158W YIL158W YIL158W YPD SGD MIPS 1.13 1.12 1.01 0.99 1.69 2.00 1.84 1.84 undocumented New questionable ORF 5.693 2.306 1 w 417 attACGCGaagta sucrose utilization invertase G2/M 677 194 YIL162W SUC2 SUC2 YPD SGD MIPS 10.33 3.85 6.30 0.16 1.01 1.84 1.37 1.37 viable New Beta-fructofuranosidase 2 (invertase) 1.731 1.803 1 w 426 aatACGCGTagc gluconeogenesis serine dehydratase G2/M 798 61 YIL167W YIL167W YIL167W YPD SGD MIPS 1.68 1.10 1.36 0.74 1.37 1.35 1.36 0.73 viable New "Serine dehydratase, converts serine to pyruvate and ammonia for gluconeogenesis " 2.482 0.597 1 c 174 TAAACCAGCATT 1 c 174 TAAACCAGCATT gluconeogenesis serine dehydratase G2/M 765 32 YIL168W SDL1 SDL1 YPD SGD MIPS 1.84 1.45 1.63 0.61 1.27 1.03 1.11 1.11 viable New "Serine dehydratase, converts serine to pyruvate and ammonia for gluconeogenesis " 2.051 1.033 unknown similar to subtelomerically-encoded proteins G1 149 595 YIL177C YIL177C YIL177C YPD SGD MIPS 1.71 2.12 1.90 1.90 1.63 1.04 1.25 0.80 undocumented New Protein with similarity to other subtelomerically-encoded proteins 3.884 -0.713 1 w 595 ctgACGCGccata 1 w 595 ctgACGCGccata unknown unknown S/G2 506 683 YIR010W YIR010W YIR010W YPD SGD MIPS 2.35 1.36 1.79 1.79 1.10 1.37 1.23 0.82 undocumented New novel 2.420 3.142 sulfur amino acid metbolism transcriptional activator S 431 642 YIR017C MET28 MET28 YPD SGD MIPS 1.54 1.05 1.27 1.27 2.25 1.47 1.82 0.55 viable New "Transcriptional activator of the basic leucine zipper (bZIP) family, works with Met4p and Cbf1p to regulation sulfur amino acid metabolism " 2.166 -2.478 unknown similar to proteins of the short-chain alcohol M/G1 86 334 YIR036C YIR036C YIR036C YPD SGD MIPS 1.25 1.22 1.24 0.81 1.50 1.12 1.30 0.77 undocumented New Protein with similarity to proteins of the short-chain alcohol dehydrogenase family and to 7-alpha-hydroxysteroid dehydrogenase 1.549 -0.274 w 571 TAACTTGTGGGG unknown unknown G1 124 4 YJL015C YJL015C YJL015C YPD SGD MIPS 1.16 1.02 1.07 0.94 1.73 1.13 1.24 0.81 undocumented New "Protein of unknown function, overlaps with YJL016W " 1.363 -0.582 1 w 699 aagACGCGagaat 1 w 699 aagACGCGagaat 1 w 346 CTCACCAGCTAG unknown unknown G1 319 484 YJL018W YJL018W YJL018W YPD SGD MIPS 1.52 1.81 1.66 1.66 1.23 1.56 1.39 0.72 undocumented New "Questionable ORF, overlaps with YJL018W " 2.240 -1.543 unknown unknown G1 362 485 YJL019W YJL019W YJL019W YPD SGD MIPS 2.33 1.87 2.09 2.09 1.22 1.02 1.12 0.90 undocumented New novel 2.899 -1.784 3 w195 agaCGCGAAAatg w 439 gggACGCGattga w 196 gagACGCGaaaat 1 w195 agaCGCGAAAatg 2 w 439 gggACGCGattga w 196 gagACGCGaaaat secretion GTPase-activating protein for Ypt6 M/G1 7 316 YJL044C GYP6 GYP6 YPD SGD MIPS 1.88 2.04 1.96 0.51 1.12 1.67 1.22 1.22 undocumented New GTPase-activating protein for Ypt6p 2.523 0.431 3 c 245 TAAACCAGCGCA w 307 CATGCCAGCCGT C 245 TAAACCAGCGCA 2 w 307 CATGCCAGCCGT C 245 TAAACCAGCGCA 1 c 245 TAAACCAGCGCA unknown unknown G2/M 635 226 YJL051W YJL051W YJL051W YPD SGD MIPS 1.27 1.09 1.08 0.93 2.50 2.31 2.40 2.40 undocumented New novel 6.092 2.073 1 w 255 CCTTTTTGGGAAATAAGTAAACAA 1 w 255 CCTTTTTGGGAAATAAGTAAACAA 1 c 631 GATACCAGCGGA unknown similar to kynurenine aminotransferase S/G2 509 711 YJL060W YJL060W YJL060W YPD SGD MIPS 3.79 1.33 2.25 2.25 1.46 1.28 1.07 0.94 undocumented New Protein with similarity to kynurenine aminotransferase 2.900 3.134 unknown unknown M/G1 17 330 YJL067W YJL067W YJL067W YPD SGD MIPS 1.38 1.27 1.32 0.76 1.26 1.43 1.34 0.74 undocumented New Protein of unknown function 1.745 0.329 2 c 252 AAGACCAGCATG C 252 AAGACCAGCATG 1 w 53 cacACGCGcaagg 1 C 252 AAGACCAGCATG 1 c 252 AAGACCAGCATG unknown unknown G1 336 394 YJL072C YJL072C YJL072C YPD SGD MIPS 1.98 1.05 1.37 1.37 1.51 1.12 1.30 0.77 undocumented New novel 1.851 -1.601 1 c 469 CGCACCAGCGAT mating; nuclear fusion DnaJ-like protein G1 219 457 YJL073W JEM1 JEM1 YPD SGD MIPS 2.33 1.13 1.62 1.62 1.63 1.48 1.55 0.65 viable New "DnaJ-like protein, required for nuclear fusion" 2.005 -1.135 2 w82 ctaACGCGTcgc c 78 aagACGCGACGCG 1 w82 ctaACGCGTcgc 1 c 78 aagACGCGACGCG 1 w 601 AAAACCAGCGGT 1 w 601 AAAACCAGCGGT chromatin structure cohesin G1 226 505 YJL074C SMC3 SMC3 YPD SGD MIPS 2.36 1.44 1.84 1.84 2.66 1.19 1.77 0.56 lethal New "Cohesin, coiled-coil protein of the SMC family involved in chromosome condensation and segregation" 4.700 -1.162 4 w310 cgaCGCGAAAaat w258 cgaCGCGAAAaaa w 311 acgACGCGaaaaa w 264 gcgACGCGACGCG 2 w310 cgaCGCGAAAaat w258 cgaCGCGAAAaaa 2 w 311 acgACGCGaaaaa w 264 gcgACGCGACGCG unknown similar to plant PR-pathogen related proteins G1 190 289 YJL078C PRY3 PRY3 YPD SGD MIPS 3.99 1.08 1.92 0.52 2.01 1.03 1.44 0.69 undocumented New has strong similarity to Pry1p and Pry2p 6.460 -0.985 1 w541 ggaACGCGTcgc 1 w541 ggaACGCGTcgc 1 c 487 AGAACCAGCCAT unknown similar to plant PR-pathogen related proteins G2/M 792 70 YJL079C PRY1 PRY1 YPD SGD MIPS 3.67 1.10 2.01 0.50 4.60 3.46 3.99 3.99 undocumented New Protein expressed under starvation conditions 6.259 0.682 unknown similar to Can1p G1 377 730 YJL091C YJL091C YJL091C YPD SGD MIPS 1.31 1.22 1.26 1.26 2.14 1.10 1.53 0.65 viable New null mutants grow very slowly; contains 12 putative transmembrane domains 1.575 -1.921 1 c 69 ttcACGCGagcat 1 c 69 ttcACGCGagcat 1 w 666 TATACCAGCATT meiosis DNA helicase S 446 737 YJL092W HPR5 HPR5 YPD SGD MIPS 1.74 1.82 1.78 1.78 1.94 1.39 1.64 0.61 viable Known "DNA helicase involved in DNA repair, suppressor of rad6 and rad18 mutations" 1.737 -2.593 1 w147 attACGCGTtat 1 w147 attACGCGTtat cell wall biogenesis chitin biosynthesis S/G2 516 622 YJL099W CHS6 CHS6 YPD SGD MIPS 1.05 1.04 1.05 1.05 1.18 1.02 1.10 1.10 viable New "Protein with tetratricopeptide (TPR) repeats involved for chitin synthase Chs3p activity, mutants are resistant to calcofluor white " 1.460 3.112 transcription anti-silencing protein G1 250 430 YJL115W ASF1 ASF1 YPD SGD MIPS 1.59 1.19 1.38 1.38 2.04 1.59 1.80 0.56 undocumented Known Anti-silencing protein that causes depression of silent loci when overexpressed 6.176 -1.259 4 c330 taaCACGAAAttc w306 cggCGCGAAAttt c297 ctcCGCGAAAaat c 317 cggACGCGatttt 1 c330 taaCACGAAAttc 2 w306 cggCGCGAAAttt c297 ctcCGCGAAAaat 1 c 317 cggACGCGatttt 1 w 698 AAGGCCAGCTTC unknown unknown S 472 687 YJL118W YJL118W YJL118W YPD SGD MIPS 1.29 1.19 1.04 0.96 1.21 1.16 1.19 0.84 undocumented New novel 4.111 -2.877 2 w 19 gacCACGAAAaaa c 80 caaACGCGcttat 1 w 19 gacCACGAAAaaa 1 c 80 caaACGCGcttat unknown unknown S 477 628 YJL119C YJL119C YJL119C YPD SGD MIPS 1.50 1.02 1.24 0.81 1.15 1.39 1.26 0.79 undocumented New Protein of unknown function 2.055 -2.938 sphingolipid metabolism sphingoid base-phosphate phosphatase S/G2 546 679 YJL134W LCB3 LCB3 YPD SGD MIPS 1.37 1.59 1.08 0.93 1.44 1.12 1.27 0.79 viable New "Sphingoid base-phosphate phosphatase, a key regulator of sphingolipid metabolism and stress response " 2.080 2.943 1 w 650 gagACGCGgcgaa 1 w 650 gagACGCGgcgaa 3 w 668 CCCACCAGCTCC w 307 TCAACCAGCTAT w 37 CAGACCAGCGGA 1 w 37 CAGACCAGCGGA glycogen metabolism glycogen synthesis initiator S/G2 554 675 YJL137C GLG2 GLG2 YPD SGD MIPS 2.34 1.53 1.89 1.89 1.26 1.23 1.01 1.01 viable New Self-glucosylating initiator of glycogen synthesis 1.841 2.806 cell cycle Cdc28p kinase inhibitor G2/M 795 84 YJL157C FAR1 FAR1 YPD SGD MIPS 10.57 1.28 3.68 0.27 7.57 1.19 2.52 2.52 viable Known Inhibitor of Cdc28p/Cln1p and Cdc28p/Cln2p complexes involved in cell cycle arrest for mating 6.488 0.639 2 w 236 TATGCCAGCCTT w 154 TTTCCCTTTTAGGAAA 2 w 123 tttCGCGAAAtct c 126 tttCGCGAAActg 1 w 328 taaACGCGTaat 1 w 236 TATGCCAGCCTT 1 w 154 TTTCCCTTTTAGGAAA unknown unknown S/G2 553 715 YJL158C CIS3 CIS3 YPD SGD MIPS 2.92 2.07 2.46 2.46 2.47 1.84 2.13 0.47 undocumented New cik1 suppressor; Protein with similarity to members of the Pir1p/Hsp150p/Pir3p family 1.709 2.835 heat shock response secreted glycoprotein of HSP family M/G1 44 276 YJL159W HSP150 HSP150 YPD SGD MIPS 4.23 5.00 4.60 0.22 1.47 1.22 1.34 1.34 viable New member of the Pir1p/Hsp150p/Pir3p family 10.860 0.050 2 c 550 GCGGCCAGCAAC C 550 GCGGCCAGCAAC 1 C 550 GCGGCCAGCAAC 1 c 550 GCGGCCAGCAAC w 119 CCCAATGTAGAAAAGTACATCATATGAAACA DNA replication "replication factor A, 13 kD subunit" G1 394 751 YJL173C RFA3 RFA3 YPD SGD MIPS 2.74 1.39 1.95 1.95 1.39 1.72 1.55 0.65 lethal Known "DNA replication factor A, 13K subunit" 3.471 -2.125 3 w 313 taaCACGAAAaat c 156 gatCGCGAAAttt w 270 taaACGCGTaat 1 w 313 taaCACGAAAaat 1 c 156 gatCGCGAAAttt 1 w 270 taaACGCGTaat unknown unknown G1 197 493 YJL181W YJL181W YJL181W YPD SGD MIPS 1.44 1.33 1.04 1.04 1.92 1.04 1.41 0.71 undocumented New has similarity to Yjr030p 3.648 -1.007 4 c166 acgCGCGAAAacg w172 gtgACGCGTttt w 17 agtACGCGcaaac c 163 ctgACGCGcgaaa 1 c166 acgCGCGAAAacg 1 w172 gtgACGCGTttt 2 w 17 agtACGCGcaaac c 163 ctgACGCGcgaaa cell cycle negative regulator of Cdc28p G1 284 520 YJL187C SWE1 SWE1 YPD SGD MIPS 3.48 1.88 2.56 2.56 2.25 1.41 1.78 0.56 viable Known Serine/tyrosine dual-specificity protein kinase able to phosphorylate Cdc28p on tyrosine and inhibit its activity 4.635 -1.390 2 w116 gcgACGCGTgag w 121 gcgACGCGACGCG 1 w116 gcgACGCGTgag 1 w 121 gcgACGCGACGCG 1 c 600 CGAACCAGCACT 1 c 600 CGAACCAGCACT DNA replication pre-initiation complex formation M/G1 9 54 YJL194W CDC6 CDC6 YPD SGD MIPS 1.01 1.02 1.00 1.00 1.59 1.11 1.20 0.84 lethal Known "Protein that regulates initiation of DNA replication through binding to origins of replication at the end of mitosis, directing the assembly of MCM proteins and the pre-replication complex " 4.130 0.415 unknown unknown M/G1 12 53 YJL195C YJL195C YJL195C YPD SGD MIPS 1.31 1.07 1.10 0.91 1.03 1.08 1.02 0.98 undocumented New Protein of unknown function 3.298 0.361 fatty acid metabolism fatty acid elongation protein M/G1 61 381 YJL196C ELO1 ELO1 YPD SGD MIPS 1.31 1.41 1.36 0.74 2.18 1.09 1.41 0.71 viable New Fatty acid elongation protein involved in elongation of tetradecanoic acid to hexadecanoic acid 1.838 -0.090 2 w 411 TCTGCCAGCCAA c 394 TTACCCACTTAGGAAA 1 w 360 ccgACGCGTgag 2 c 160 ccgACGCGggtaa c 349 gcgACGCGaggcc 1 w 411 TCTGCCAGCCAA cell wall biogenesis unknown S 423 739 YJL201W ECM25 ECM25 YPD SGD MIPS 2.27 1.12 1.59 1.59 1.03 1.02 1.03 0.98 undocumented New Protein possibly involved in cell wall structure or biosynthesis 2.302 -2.420 unknown unknown G1 189 348 YJL217W YJL217W YJL217W YPD SGD MIPS 2.83 1.39 1.43 0.70 2.18 1.52 1.82 0.55 undocumented New novel 2.690 -0.972 1 w300 aaaACGCGTggc 1 w300 aaaACGCGTggc 1 c 293 GCTACCAGCCAC w 458 GAAATTGTGGGG unknown similar to other subtelomerically-encoded proteins M/G1 109 592 YJL225C YJL225C YJL225C YPD SGD MIPS 1.24 1.57 1.39 1.39 1.74 1.36 1.13 0.88 undocumented New Protein with similarity to other subtelomerically-encoded proteins 3.694 -0.501 1 w 595 ctgACGCGccata unknown major facilitator superfamily S/G2 486 712 YJR001W YJR001W YJR001W YPD SGD MIPS 2.87 1.52 2.09 2.09 1.06 1.12 1.03 0.97 undocumented New "similarity to YNL101w and C.elegans hypothetical protein T20G5.6, weak similarity to A.thaliana aminoacid permease AAP4; member of the major facilitator superfamily (MFS) " 1.545 -3.001 2 w 228 acaACGCGTctt c 186 aaaACGCGatgaa 1 w 228 acaACGCGTctt 1 c 186 aaaACGCGatgaa unknown similar to human collagen alpha 3 (VI) chain G2/M 658 109 YJR003C YJR003C YJR003C YPD SGD MIPS 1.60 1.14 1.19 0.84 1.42 1.15 1.28 0.78 undocumented New Protein with weak similarity to human collagen alpha 3 (VI) chain precursor 1.809 1.919 mating alpha-agglutinin M/G1 110 302 YJR004C SAG1 SAG1 YPD SGD MIPS 1.01 1.10 1.05 0.95 1.54 1.30 1.09 0.92 undocumented New alpha-Agglutinin involved in cell-cell interactions during mating 3.383 -0.512 DNA replication polymerase delta 55 KD subunit G1 318 431 YJR006W HUS2 HYS2 YPD SGD MIPS 1.57 1.46 1.52 1.52 2.62 1.04 1.65 0.61 lethal New Aka POL31; Small subunit of dna polymerase delta 2.271 -1.542 1 w110 cagACGCGTctg 1 w110 cagACGCGTctg methionine biosynthesis sulfate adenylyltransferase S/G2 504 650 YJR010W MET3 MET3 YPD SGD MIPS 7.30 1.15 2.52 2.52 1.33 1.43 1.38 0.73 viable New ATP-sulfurylase (sulfate adenylyltransferase) 4.410 3.142 1 w 416 ccaACGCGcatcc 1 w 416 ccaACGCGcatcc unknown unknown G1 198 429 YJR030C YJR030C YJR030C YPD SGD MIPS 1.01 1.50 1.23 1.23 1.81 1.41 1.60 0.63 undocumented New has similarity to Yjl181p 2.368 -1.021 2 c193 tgaCACGAAAaaa w234 ctaACGCGTcgc 1 c193 tgaCACGAAAaaa 1 w234 ctaACGCGTcgc DNA replication polymerase delta 55 kD subunit G1 308 611 YJR043C POL32 POL32 YPD SGD MIPS 1.89 1.34 1.59 1.59 2.23 1.00 1.49 0.67 viable New Small subunit of DNA polymerase delta 1.864 -1.504 3 w127 acaCGCGAAActc w145 taaACGCGTatg w 128 aacACGCGaaact 1 w127 acaCGCGAAActc 1 w145 taaACGCGTatg 1 w 128 aacACGCGaaact oxidative phosphorylation cytochrome-c isoform 1 S/G2 564 117 YJR048W CYC1 CYC1 YPD SGD MIPS 1.24 1.72 1.46 1.46 1.25 1.08 1.16 0.86 viable New "Cytochrome-c isoform 1, member of the cytochrome bc1 complex, predominant isoform during aerobic growth " 1.351 2.696 1 w 267 cccACGCGTagg 1 w 267 cccACGCGTagg unknown unknown G1 181 312 YJR054W YJR054W YJR054W YPD SGD MIPS 2.79 1.73 2.20 2.20 2.60 1.49 1.97 0.51 undocumented New has similarity to Yml047p 1.846 -0.935 2 c198 agaCGCGAAAtgt c197 cagACGCGaaatg 1 c198 agaCGCGAAAtgt 1 c197 cagACGCGaaatg "bud site selection, axial" unknown G2/M 621 220 YJR092W BUD4 BUD4 YPD SGD MIPS 1.06 1.11 1.02 1.02 2.27 1.55 1.88 1.88 viable New required for bud site selection but not for default mating 4.456 2.168 1 AATAGATGACCCGATTTGGAAAAAGGTAAACAACAATG 1 AATAGATGACCCGATTTGGAAAAAGGTAAACAACAATG unknown unknown S/G2 567 617 YJR110W YJR110W YJR110W YPD SGD MIPS 1.21 2.05 1.30 1.30 1.46 1.30 1.06 0.94 undocumented New Protein tyrosine phosphatase (PTPase) of unknown function 1.544 2.633 cell wall biogenesis unknown S 480 652 YJR137C ECM17 ECM17 YPD SGD MIPS 3.46 1.58 2.34 2.34 1.66 1.04 1.31 0.76 viable New Putative sulfite reductase (ferredoxin) 2.395 -2.970 c 73 AACTAGCTGGGG branched chain amino acid biosynthesis transaminase G1 322 386 YJR148W BAT2 BAT2 YPD SGD MIPS 2.15 1.54 1.82 0.55 1.20 2.18 1.35 1.35 viable New Cytosolic branched-chain amino acid transaminase 3.070 -1.567 1 w 609 GATACCAGCATT unknown unknown G1 313 407 YJR154W YJR154W YJR154W YPD SGD MIPS 1.33 1.10 1.10 0.91 2.62 1.10 1.70 0.59 undocumented New Protein of unknown function 1.512 -1.514 2 w114 gtgACGCGTctg w 296 ataACGCGaagtg 1 w114 gtgACGCGTctg 1 w 296 ataACGCGaagtg w 562 ATTTGTGCGGGG unknown hypothetical aryl-alcohol dehydrogenase G1 158 408 YJR155W AAD10 AAD10 YPD SGD MIPS 1.22 1.04 1.13 0.89 1.63 1.23 1.42 0.71 undocumented New Protein with similarity to aryl-alcohol dehydrogenase 1.620 -0.767 1 c 195 TATACCAGCTGT sulfate assimilation adenylylsulfate kinase S 443 648 YKL001C MET14 MET14 YPD SGD MIPS 1.04 1.08 1.06 1.06 1.36 1.07 1.20 0.83 undocumented New "Adenosine-5'-phosphosulfate 3'-phosphotransferase (adenylylsulfate kinase), part of the sulfate assimilation pathway " 3.206 -2.579 1 w 397 ATCACCAGCTCG sphingolipid metabolism phosphatidylinositol:ceramide phosphoinositol transferase S/G2 597 662 YKL004W AUR1 AUR1 YPD SGD MIPS 1.10 1.43 1.14 0.88 1.63 1.07 1.23 0.81 lethal New "Phosphatidylinositol:ceramide phosphoinositol transferase (IPC synthase), essential for sphingolipid synthesis" 1.905 2.393 unknown "similar to Lag1p, has 6 potential transmembrane" S 427 781 YKL008C YKL008C YKL008C YPD SGD MIPS 6.72 1.50 3.17 3.17 1.42 1.28 1.05 1.05 undocumented New "Protein with similarity to Lag1p, has 6 potential transmembrane domains " 4.750 -2.442 2 w 545 cgaCGCGAAAaaa w 551 aaaACGCGACGCG 1 w 545 cgaCGCGAAAaaa 1 w 551 aaaACGCGACGCG pyrimidine metabolism "UGP1, UDP-glucose pyrophosphorylase" S/G2 501 249 YKL035W UGP1 UGP1 YPD SGD MIPS 2.19 1.43 1.24 1.24 1.13 2.13 1.37 1.37 lethal New UDP-glucose pyrophosphorylase (UTP-glucose-1-P uridylyltransferase) (UGPase) 2.010 -3.122 1 w 244 ctgACGCGcttcc 1 w 244 ctgACGCGcttcc cytoskeleton spindle pole body component G1 258 444 YKL042W SPC42 SPC42 YPD SGD MIPS 1.37 1.11 1.23 1.23 6.23 1.25 2.79 0.36 lethal Known Component of the spindle pole body 2.643 -1.290 2 w219 tttACGCGTttt w183 taaACGCGTaaa 2 w219 tttACGCGTttt w183 taaACGCGTaaa pseudohyphal growth transcription factor G2/M 715 16 YKL043W PHD1 PHD1 YPD SGD MIPS 1.07 1.10 1.01 0.99 1.84 1.02 1.34 0.74 viable New Transcription factor involved in regulation of filamentous growth 2.011 1.562 unknown unknown G2/M 730 17 YKL044W YKL044W YKL044W YPD SGD MIPS 1.50 1.56 1.02 1.02 1.90 1.10 1.45 0.69 undocumented New Protein of unknown function 1.442 1.418 1 w 487 taaACGCGgtcgg DNA replication polymerase alpha 58 kD subunit (DNA primase) G1 210 533 YKL045W PRI2 PRI2 YPD SGD MIPS 2.11 1.56 1.81 1.81 1.71 1.61 1.66 0.60 lethal Known "DNA polymerase alpha 58 kDa subunit, DNA primase (large subunit) involved in synthesis of RNA primers for Okazaki fragments" 6.044 -1.087 2 w287 tggACGCGTtga w262 gtgACGCGTaaa 2 w287 tggACGCGTtga w262 gtgACGCGTaaa pseudohyphal growth protein kinase S/G2 507 667 YKL048C ELM1 ELM1 YPD SGD MIPS 1.34 1.34 1.34 1.34 1.11 1.32 1.21 0.83 undocumented New Serine/threonine protein kinase regulating pseudohyphal growth 3.080 3.136 1 c 535 GTTACCAGCCGG unknown unknown S/G2 519 666 YKL052C YKL052C YKL052C YPD SGD MIPS 1.16 1.00 1.08 1.08 1.96 1.22 1.55 0.65 undocumented New Protein of unknown function 2.161 3.104 1 c 370 CTTGCCAGCCAT unknown ER 25 kDa transmembrane protein S 484 350 YKL065C YET1 YET1 YPD SGD MIPS 1.08 1.67 1.34 0.74 1.36 1.33 1.35 0.74 viable New Transmembrane protein of the endoplasmic reticulum 1.446 -2.990 unknown unknown G1 360 397 YKL066W YKL066W YKL066W YPD SGD MIPS 1.19 1.34 1.06 1.06 1.51 1.32 1.41 0.71 undocumented New Protein of unknown function 2.792 -1.762 2 c670 agaCACGAAAcga c 688 attACGCGccttt 1 c670 agaCACGAAAcga 1 c 688 attACGCGccttt nucleotide metabolism nucleoside diphosphate kinase G1 375 396 YKL067W YNK1 YNK1 YPD SGD MIPS 1.23 1.43 1.33 1.33 1.75 1.75 1.75 0.57 viable New "Nucleoside diphosphate kinase, responsible for synthesis of all nucleoside triphosphates except ATP " 3.934 -1.908 2 c201 agaCACGAAAcga c 219 attACGCGccttt 1 c201 agaCACGAAAcga 1 c 219 attACGCGccttt 2 c 247 CTCGCCAGCCCA c 546 TGCGCCAGCTTC unknown unknown S/G2 549 678 YKL069W YKL069W YKL069W YPD SGD MIPS 1.20 1.09 1.14 0.88 1.47 1.18 1.31 0.76 undocumented New Protein of unknown function 2.741 2.881 mitosis centromere protein G1 300 449 YKL089W MIF2 MIF2 YPD SGD MIPS 1.69 1.33 1.50 1.50 2.02 1.33 1.64 0.61 lethal New Catalytic (alpha) subunit of the mitochondrial processing peptidase 1.963 -1.453 1 w98 ataACGCGTtag 1 w98 ataACGCGTtag cell wall protein "beta-1,6-glucan acceptor" S/G2 512 710 YKL096W CWP1 CWP1 YPD SGD MIPS 3.54 1.99 2.65 2.65 2.38 2.50 2.44 0.41 viable Known "Mannoprotein of the cell wall, member of the PAU1 family" 6.010 3.127 3 c 317 aagCGCGAAAttt c 438 aaaACGCGcatat c 697 agaACGCGgtatt 1 c 317 aagCGCGAAAttt 2 c 438 aaaACGCGcatat c 697 agaACGCGgtatt unknown cell wall protein S/G2 600 703 YKL096W-A CWP2 CWP2 YPD SGD MIPS 1.19 1.03 1.08 1.08 1.49 1.39 1.44 0.70 viable Known "Mannoprotein of the cell wall, member of the PAU1 family" 2.031 2.353 w 578 CTTTTGCCGGGG cell cycle negative regulator of swe1 kinase G1 350 438 YKL101W HSL1 HSL1 YPD SGD MIPS 8.71 2.91 5.03 5.03 3.88 1.85 2.68 0.37 viable Known Serine/threonine protein kinase that interacts genetically with histone mutations 4.447 -1.701 5 w 411 agaACGCGcatct w 392 aagACGCGccctt w 342 ttcACGCGctttg w 50 gtaACGCGctttt c 359 acgACGCGccttc 5 w 411 agaACGCGcatct w 392 aagACGCGccctt w 342 ttcACGCGctttg w 50 gtaACGCGctttt c 359 acgACGCGccttc 1 w 423 AGAACCAGCAAA 1 w 423 AGAACCAGCAAA protein degradation vacuolar aminopeptidase ysc1 G1 268 338 YKL103C LAP4 LAP4 YPD SGD MIPS 2.14 1.60 1.85 1.85 1.01 1.89 1.36 0.73 viable New Aminopeptidase I (yscI) (API) of the vacuole 2.100 -1.330 1 c404 cctCACGAAAtgg 1 c404 cctCACGAAAtgg cell wall biogenesis chitin biosynthesis M/G1 50 60 YKL104C GFA1 GFA1 YPD SGD MIPS 1.06 1.33 1.19 0.84 1.41 1.05 1.16 0.86 undocumented New "Glucosamine--fructose-6-phosphate aminotransferase, isomerizing (hexosephosphate aminotransferase), first step in chitin biosynthesis pathway " 1.617 0.014 2 w 106 AAAGCCAGCATA w 106 AAAGCCAGCATA 1 w 415 gtaACGCGcggct 1 w 106 AAAGCCAGCATA 1 w 106 AAAGCCAGCATA DNA replication unknown; interacts with Dpb11p G1 171 428 YKL108W YKL108W SLD2 YPD SGD MIPS 1.08 1.12 1.10 1.10 1.58 1.35 1.46 0.68 undocumented New novel 3.528 -0.826 2 w499 aatCACGAAAaca w112 tttACGCGTatg 1 w499 aatCACGAAAaca 1 w112 tttACGCGTatg DNA repair ssDNA endonuclease G1 180 512 YKL113C RAD27 RAD27 YPD SGD MIPS 4.64 2.09 3.11 3.11 2.32 1.67 1.97 0.51 viable Known Single-stranded DNA endonuclease and 5'-3' exonuclease that functions in the MSH2-MLH1-PMS1-dependent mismatch repair system; promoter contains 2 MluI cell cycle box (MCB) elements 3.445 -0.932 5 c245 aaaCACGAAActa w495 tttACGCGTttt w445 aaaACGCGTaaa w374 taaACGCGTcat w309 aggACGCGTaaa 1 c245 aaaCACGAAActa 4 w495 tttACGCGTttt w445 aaaACGCGTaaa w374 taaACGCGTcat w309 aggACGCGTaaa unknown putative protein kinase M/G1 77 281 YKL116C YKL116C YKL116C YPD SGD MIPS 1.13 1.05 1.03 1.03 1.82 1.09 1.29 0.77 undocumented New most similar to GIN4 5.073 -0.212 1 c 320 caaCGCGAAAcat 3 w 129 tcaACGCGgggtg c 319 gcaACGCGaaaca c 599 cttACGCGattta glycolysis phosphoglucomutase G1 402 800 YKL127W PGM1 PGM1 YPD SGD MIPS 2.19 3.06 2.59 2.59 2.62 1.06 1.67 0.60 viable New "Phosphoglucomutase, minor isoform, interconverts Glc-1-P and Glc-6-P " 3.412 -2.234 3 c144 aaaCGCGAAAtac c 143 taaACGCGaaata c 525 catACGCGctacc 1 c144 aaaCGCGAAAtac 2 c 143 taaACGCGaaata c 525 catACGCGctacc c 480 TAACAGCTGGGG cell polarity asymmetric HO expression G2/M 666 221 YKL130C SHE2 SHE2 YPD SGD MIPS 1.20 1.28 1.24 0.81 1.13 2.24 1.59 1.59 viable New Protein required for mother cell-specific expression of HO 2.370 1.876 unknown unknown M/G1 27 329 YKL151C YKL151C YKL151C YPD SGD MIPS 2.06 1.22 1.59 0.63 1.17 1.16 1.17 1.17 undocumented New Protein of unknown function 1.506 0.252 1 w 238 GTTACCAGCTTG 1 w 238 GTTACCAGCTTG unknown similar to members of the Pir1p/Hsp150p/Pir3p M/G1 49 278 YKL163W PIR3 PIR3 YPD SGD MIPS 4.46 4.35 4.40 0.23 1.64 1.51 1.57 1.57 viable New has 80% identity to Hsp150p 12.510 0.028 unknown Pir1p/Hsp150p/Pir3p family M/G1 59 277 YKL164C PIR1 PIR1 YPD SGD MIPS 3.83 5.56 4.61 0.22 1.23 1.51 1.36 1.36 viable New "has 84% identity to Hsp150p ; unlike HSP150, PIR1 transcription is not induced by heat; pir1 pir2 double null mutant has slow growth and is heat sensitive" 15.990 -0.080 3 w 668 AGCACCAGCACT w 433 TCGGCCAGCTTG C 212 TATACCAGCGTT 3 w 668 AGCACCAGCACT w 433 TCGGCCAGCTTG C 212 TATACCAGCGTT sporulation morphogenesis checkpoint G1 259 447 YKL165C MCD4 MCD4 YPD SGD MIPS 2.45 1.61 1.99 1.99 1.83 1.32 1.55 0.64 lethal New morphogenesis checkpoint protein; 2.577 -1.295 2 w119 aaaCGCGAAAaaa w 120 taaACGCGaaaaa 1 w119 aaaCGCGAAAaaa 1 w 120 taaACGCGaaaaa unknown unknown; EBNA1-binding protein homolog G2/M 656 366 YKL172W YKL172W EBP2 YPD SGD MIPS 1.31 1.75 1.52 0.66 1.83 1.23 1.22 0.82 undocumented New Protein of unknown function 6.716 1.939 1 c 351 catCACGAAAtca unknown unknown M/G1 73 303 YKL177W YKL177W YKL177W YPD SGD MIPS 2.00 1.50 1.15 0.87 1.46 1.20 1.32 0.76 undocumented New Protein of unknown function 4.526 -0.171 mating a-factor receptor M/G1 60 304 YKL178C STE3 STE3 YPD SGD MIPS 1.43 1.30 1.05 0.95 1.77 1.01 1.34 0.75 undocumented New "Pheromone a-factor receptor, seven-transmembrane domain protein " 4.254 -0.080 1 C 360 TGTACCAGCGCT 1 C 360 TGTACCAGCGCT 1 w 595 TTTCCCACTAAGGAAA fatty acid metabolism "fatty-acyl-CoA synthase, beta subunit" M/G1 106 260 YKL182W FAS1 FAS1 YPD SGD MIPS 1.15 1.40 1.10 1.10 1.34 1.16 1.08 0.93 undocumented New "Fatty-acyl-CoA synthase, beta chain (contains acetyl transferase, enoyl reductase, dehydratase, and malonyl/palmitoyl transferase)" 1.377 -0.490 unknown unknown S/G2 599 110 YKL183W YKL183W YKL183W YPD SGD MIPS 1.46 1.47 1.00 1.00 1.49 1.43 1.46 0.69 undocumented New Protein of unknown function 1.335 2.367 mating type switching transcription factor M/G1 35 279 YKL185W ASH1 ASH1 YPD SGD MIPS 3.08 1.41 2.08 0.48 1.15 1.32 1.07 0.93 viable Known asymmetric synthesis of HO; also involved in pseudohyphal development 11.800 0.159 4 w 643 CTAGCCAGCAAA w 467 TGAGCCAGCAAT w 643 CTAGCCAGCAAA w 467 TGAGCCAGCAAT 1 c 667 taaACGCGcgcag 2 w 643 CTAGCCAGCAAA w 467 TGAGCCAGCAAT 2 w 643 CTAGCCAGCAAA w 467 TGAGCCAGCAAT mating a-factor exporter (ABC superfamily) G2/M 786 58 YKL209C STE6 STE6 YPD SGD MIPS 1.82 1.52 1.66 0.60 1.15 1.03 1.05 1.05 viable New "transporter, responsible for a-factor export" 1.771 0.793 2 w 698 ttaACGCGcgata w 394 ataACGCGacata DNA replication (putative) interacts with DNA S 462 685 YKR010C TOF2 TOF2 YPD SGD MIPS 1.49 1.48 1.49 1.49 1.14 1.24 1.19 0.84 viable New Protein that interacts with DNA topoisomerase I 2.672 -2.750 1 w 242 catCACGAAAaaa 1 w 242 catCACGAAAaaa unknown unknown G1 321 479 YKR012C YKR012C YKR012C YPD SGD MIPS 3.47 3.69 3.58 3.58 3.34 2.78 3.05 0.33 undocumented New novel; questionable ORF 6.980 -1.564 2 c 274 CCTACCAGCACA c 643 ATTACCAGCTAC unknown similar to plant PR-pathogen related proteins G1 334 480 YKR013W PRY2 PRY2 YPD SGD MIPS 7.02 4.98 5.91 5.91 4.22 4.00 4.11 0.24 undocumented New expressed under starvation conditions 9.805 -1.601 3 c209 ataCACGAAAtgt w365 attCGCGAAAtgc c380 cgcCGCGAAAgtc 1 c209 ataCACGAAAtgt 2 w365 attCGCGAAAtgc c380 cgcCGCGAAAgtc unknown unknown G2/M 678 190 YKR021W YKR021W YKR021W YPD SGD MIPS 1.21 1.28 1.25 0.80 1.29 1.77 1.51 1.51 undocumented New strong similarity to hypothetical protein YJL084c 1.856 1.762 cytoskeleton spindle pole body component S 450 744 YKR037C YKR037C SPC34 YPD SGD MIPS 1.77 1.68 1.72 1.72 2.06 1.06 1.48 0.68 lethal New aka SPC34; spindle pole body protein 2.284 -2.624 1 w 99 aagCGCGAAAata 1 w 99 aagCGCGAAAata transport general amino acid permease S/G2 602 127 YKR039W GAP1 GAP1 YPD SGD MIPS 1.40 1.39 1.40 0.72 1.41 2.06 1.21 1.21 viable New "General amino acid permease, proton symport transporter for all naturally-occuring L-amino acids, 4-aminobutyric acid (GABA), ornithine, citrulline, some D-amino acids, and some toxic analogs " 2.567 2.334 unknown unknown S/G2 543 623 YKR041W YKR041W YKR041W YPD SGD MIPS 1.79 1.10 1.40 0.71 1.81 1.05 1.31 0.76 undocumented New Protein of unknown function 2.106 2.956 aging unknown G2/M 766 66 YKR042W UTH1 UTH1 YPD SGD MIPS 4.67 3.13 3.82 0.26 1.33 2.10 1.67 1.67 undocumented New "Protein involved in the aging process, mutants have longer lifespan and better viability upon starvation " 3.144 1.029 1 w 617 gctACGCGcgggc unknown unknown G2/M 615 123 YKR046C YKR046C YKR046C YPD SGD MIPS 1.44 1.32 1.37 0.73 1.40 1.25 1.32 0.76 undocumented New Protein of unknown function 1.803 2.243 1 c 357 CCTGCCAGCAAA methionine biosynthesis siroheme synthase S 461 645 YKR069W MET1 MET1 YPD SGD MIPS 1.64 1.08 1.23 1.23 1.79 1.01 1.35 0.74 viable New Siroheme synthase involved in methionine metabolism 1.709 -2.727 unknown unknown G1 152 562 YKR077W YKR077W YKR077W YPD SGD MIPS 1.05 1.69 1.33 1.33 3.45 1.19 2.03 0.49 undocumented New related to YOR066W 6.829 -0.726 4 w184 tgaCGCGAAAcgc w335 tacACGCGTtcc w178 gaaACGCGTtaa w 185 ttgACGCGaaacg 1 w184 tgaCGCGAAAcgc 2 w335 tacACGCGTtcc w178 gaaACGCGTtaa 1 w 185 ttgACGCGaaacg unknown unknown G2/M 769 103 YKR079C YKR079C YKR079C YPD SGD MIPS 1.85 1.11 1.43 0.70 2.10 1.07 1.40 0.71 undocumented New Protein of unknown function 1.429 0.975 unknown unknown G1 328 439 YKR090W YKR090W YKR090W YPD SGD MIPS 2.24 1.74 1.97 1.97 2.24 1.12 1.58 0.63 undocumented New similarity to chicken Lim protein kinase and Islet proteins 2.050 -1.571 1 c 254 aggACGCGaattg 1 c 254 aggACGCGaattg unknown unknown; suppressor of Rad53 lethality G1 323 357 YKR091W YKR091W SRL3 YPD SGD MIPS 1.13 1.23 1.04 1.04 2.67 1.54 2.03 0.49 undocumented New Suppressor of Rad53 lethality 2.210 -1.568 1 w501 tttACGCGTcat 1 w501 tttACGCGTcat 1 w 665 TTAGCCAGCCTT w 384 TTAGTTCTGGGG unknown ATP-binding cassette (ABC) superfamily M/G1 8 27 YKR103W YKR103W YKR103W YPD SGD MIPS 1.61 1.46 1.05 0.95 1.52 1.02 1.25 0.80 undocumented New "Member of the ATP-binding cassette (ABC) superfamily, possible pseudogene " 1.582 0.424 diepoxybutane and mitomycin C resistance unknown G1 263 522 YLL002W KIM2 KIM2 YPD SGD MIPS 1.82 2.06 1.94 1.94 1.21 1.33 1.27 0.79 undocumented New Protein involved in resistance to mutagens such as diepoxybutane and mitomycin C 3.831 -1.307 3 c130 gaaCACGAAAagt w 444 ccgACGCGaggaa c 123 acaACGCGaacac 1 c130 gaaCACGAAAagt 2 w 444 ccgACGCGaggaa c 123 acaACGCGaacac unknown similar to human triacylglycerol lipase G1 404 603 YLL012W YLL012W YLL012W YPD SGD MIPS 3.80 1.29 2.21 2.21 2.88 1.82 2.29 0.44 undocumented New Protein with similarity to YLR020C 1.716 -2.234 1 w 203 gaaACGCGaagga 1 w 203 gaaACGCGaagga chromatin structure interacts with histone acetyltransferase G1 310 531 YLL022C HIF1 HIF1 YPD SGD MIPS 2.16 2.82 2.47 2.47 1.47 1.72 1.59 0.63 viable New aka HIF1; Hat1 Interacting Factor 1 4.368 -1.508 3 c93 aaaCGCGAAActt w515 aaaACGCGTcac c 92 aaaACGCGaaact 1 c93 aaaCGCGAAActt 1 w515 aaaACGCGTcac 1 c 92 aaaACGCGaaact unknown major facilitator superfamily G2/M 700 162 YLL028W YLL028W YLL028W YPD SGD MIPS 1.54 1.92 1.72 0.58 1.11 1.14 1.12 1.12 undocumented New Member of major facilitator superfamily (MFS) multidrug-resistance (MFS-MDR) protein family 5.468 1.621 1 w 482 cggACGCGgaagg 1 w 677 TTTGCCAGCCAG c 605 ATTAGCGTGGGG unknown unknown S/G2 589 673 YLL032C YLL032C YLL032C YPD SGD MIPS 1.17 1.22 1.02 1.02 1.29 1.00 1.14 0.88 undocumented New weak similarity to SCP160 4.251 2.456 unknown similar to Gap1p and other amino acid permeases S 482 644 YLL061W YLL061W YLL061W YPD SGD MIPS 1.83 1.09 1.30 1.30 2.02 1.25 1.59 0.63 undocumented New Protein with similarity to Gap1p and other amino acid permeases 1.604 -2.970 1 w 561 TGCGCCAGCAAT unknown unknown S 439 647 YLL062C YLL062C YLL062C YPD SGD MIPS 3.01 1.06 1.68 1.68 1.11 1.23 1.17 0.85 undocumented New Protein of unknown function 2.518 -2.542 2 c 476 TTCACCAGCGAT c 547 CCAACCAGCCGT unknown similar to other subtelomerically-encoded proteins G1 136 593 YLL066C YLL066C YLL066C YPD SGD MIPS 2.18 1.83 2.00 2.00 1.02 1.01 1.02 0.98 undocumented New Protein with similarity to other subtelomerically-encoded proteins 3.717 -0.645 1 w42 tgtCACGAAAtag 1 w42 tgtCACGAAAtag w 585 AGATTTCTGGGG unknown similar to other subtelomerically-encoded proteins G1 117 581 YLL067C YLL067C YLL067C YPD SGD MIPS 2.04 1.59 1.80 1.80 1.28 1.09 1.08 0.92 undocumented New Protein with similarity to other subtelomerically-encoded proteins 3.423 -0.536 1 w42 tgtCACGAAAtag 1 w42 tgtCACGAAAtag unknown unknown M/G1 34 29 YLR013W YLR013W YLR013W YPD SGD MIPS 1.46 1.57 1.04 1.04 1.29 1.14 1.21 0.83 undocumented New Protein of unknown function 1.430 0.159 DNA repair DNA helicase G1 134 461 YLR032W RAD5 RAD5 YPD SGD MIPS 1.04 1.96 1.42 1.42 2.00 1.12 1.50 0.67 viable New Protein required for meiosis-specific double-stranded break repair and meiotic recombination 1.528 -0.623 2 w140 tttACGCGTcat c 165 acgACGCGccaac 1 w140 tttACGCGTcat 1 c 165 acgACGCGccaac unknown unknown G2/M 686 170 YLR034C YLR034C YLR034C YPD SGD MIPS 1.73 1.33 1.52 0.66 1.51 1.30 1.08 0.93 undocumented New Protein with similarity to Smf2p 2.163 1.711 unknown unknown M/G1 31 305 YLR040C YLR040C YLR040C YPD SGD MIPS 1.73 1.05 1.28 1.28 2.22 1.05 1.53 0.65 undocumented New Protein of unknown function 1.847 0.186 unknown unknown M/G1 30 26 YLR041W YLR041W YLR041W YPD SGD MIPS 1.76 1.20 1.21 0.83 1.24 1.23 1.24 0.81 undocumented New Protein of unknown function 2.543 0.202 1 C 256 TATGCCAGCCAA 1 C 256 TATGCCAGCCAA cytoskeleton spindle pole body component S 449 736 YLR045C STU2 STU2 YPD SGD MIPS 2.57 1.67 2.07 2.07 1.56 1.28 1.41 0.71 lethal New Component of the spindle pole body 3.242 -2.624 2 c 183 cgaCACGAAAaaa c 393 ttgCGCGAAAggt 1 c 183 cgaCACGAAAaaa 1 c 393 ttgCGCGAAAggt 1 c 532 TTAACCAGCAAT 1 c 532 TTAACCAGCAAT 1 unknown unknown G1 128 564 YLR049C YLR049C YLR049C YPD SGD MIPS 5.33 1.95 3.23 3.23 1.73 1.79 1.76 0.57 viable New novel 8.653 -0.596 4 c291 ggaCGCGAAActt w305 gaaACGCGTcac w60 atcACGCGTaca c 290 aggACGCGaaact 1 c291 ggaCGCGAAActt 2 w305 gaaACGCGTcac w60 atcACGCGTaca 1 c 290 aggACGCGaaact 1 c 270 AAAACCAGCCAT unknown similar to C-terminal region of human MAC30 G1 329 393 YLR050C YLR050C YLR050C YPD SGD MIPS 1.26 1.03 1.10 1.10 2.13 1.54 1.81 0.55 undocumented New Protein with similarity to C-terminal region of human MAC30 1.630 -1.571 sterol metabolism C-5 sterol desaturase S/G2 568 143 YLR056W ERG3 ERG3 YPD SGD MIPS 2.44 1.86 2.13 2.13 1.69 1.04 1.33 0.75 viable New "C-5 sterol desaturase, an iron non-heme oxygen-requiring enzyme of the ergosterol biosynthesis pathway " 1.657 2.611 2 w 516 aacCGCGAAAcga w 469 acgACGCGTtgt 1 w 516 aacCGCGAAAcga 1 w 469 acgACGCGTtgt unknown unknown G2/M 733 210 YLR057W YLR057W YLR057W YPD SGD MIPS 1.35 1.41 1.02 1.02 2.17 1.16 1.59 1.59 undocumented New weak similarity to mouse alpha-mannosidase 2.159 1.389 one-carbon interconversion serine hydroxymethyltransferase S/G2 583 113 YLR058C SHM2 SHM2 YPD SGD MIPS 1.15 1.82 1.45 0.69 2.15 1.02 1.45 0.69 viable New "Serine hydroxymethyltransferase (glycine hydroxymethyltransferase), interconverts serine and glycine " 1.550 2.485 1 w 289 acaCACGAAAcat 1 w 289 acaCACGAAAcat cell cycle Cdc28p-Clb5 protein kinase inhibitor M/G1 67 283 YLR079W SIC1 SIC1 YPD SGD MIPS 1.46 1.22 1.34 1.34 1.56 1.27 1.41 0.71 viable Known Clb kinase inhibitor 7.374 -0.131 3 w 170 ATAGCCAGCACA w 170 ATAGCCAGCACA C 146 CAAGCCAGCCAT 1 c 134 gcgACGCGaacaa 2 w 170 ATAGCCAGCACA C 146 CAAGCCAGCCAT 1 w 170 ATAGCCAGCACA unknown unknown G2/M 674 242 YLR084C YLR084C YLR084C YPD SGD MIPS 1.69 1.55 1.62 1.62 1.24 1.71 1.46 1.46 undocumented New novel 2.110 1.824 1 c 290 CCTAATTTGGGAATTTGTCAATAA 1 c 222 tatCGCGAAAaaa 1 c 290 CCTAATTTGGGAATTTGTCAATAA unknown unknown G2/M 701 613 YLR095C YLR095C YLR095C YPD SGD MIPS 1.35 1.37 1.36 1.36 1.08 1.28 1.18 0.85 undocumented New Protein of unknown function 2.520 1.621 1 c 361 ttaCACGAAAttc 1 c 580 gacACGCGagttg 2 c 593 TGCACCAGCCAC c 640 ATGACCAGCAAC 1 c 640 ATGACCAGCAAC ser/thr metabolism CHA1 activator G2/M 637 624 YLR098C CHA4 CHA4 YPD SGD MIPS 1.33 1.13 1.09 1.09 1.20 1.30 1.04 1.04 undocumented New "Zinc-finger protein necessary for activation of CHA1, has a Zn[2]-Cys[6] fungal-type binuclear cluster " 1.711 2.051 1 c 345 ATGGCCAGCATC 1 c 345 ATGGCCAGCATC unknown unknown S/G2 584 44 YLR099C YLR099C YLR099C YPD SGD MIPS 2.32 1.21 1.68 1.68 1.39 1.43 1.41 0.71 undocumented New Protein of unknown function 1.828 2.485 1 c 279 attCACGAAAccg 1 c 279 attCACGAAAccg unknown unknown G2/M 744 132 YLR100W YLR100W YLR100W YPD SGD MIPS 1.59 1.22 1.14 1.14 1.12 1.91 1.31 1.31 undocumented New Protein of unknown function 1.740 1.282 1 w 615 attCACGAAAccg DNA replication pre-replicative complex subunit (putative) G1 234 506 YLR103C CDC45 CDC45 YPD SGD MIPS 2.01 1.28 1.60 1.60 1.83 1.43 1.62 0.62 lethal Known functions with ORC complex and MCM proteins in the initiation of DNA replication; promoter has two perfect MluI cell cycle (MCB) boxes 4.782 -1.206 4 w406 tttACGCGTacc w380 ccaACGCGTatt c 370 aaaACGCGaagaa c 442 gggACGCGcccat 2 w406 tttACGCGTacc w380 ccaACGCGTatt 2 c 370 aaaACGCGaagaa c 442 gggACGCGcccat protein processing GPI-anchored aspartic protease G1 324 460 YLR121C YPS4 YPS4 YPD SGD MIPS 4.77 1.71 2.86 2.86 1.77 3.03 2.31 0.43 viable New "Yapsin 4, GPI-anchored aspartyl protease " 6.270 -1.568 1 c247 aagCGCGAAAaaa 1 c247 aagCGCGAAAaaa transcription CUP1 regulator G2/M 651 232 YLR131C ACE2 ACE2 YPD SGD MIPS 1.03 1.39 1.16 1.16 1.35 1.92 1.19 1.19 viable Known has 37% identity overall to Swi5p 5.996 1.961 unknown unknown G1 316 388 YLR135W YLR135W YLR135W YPD SGD MIPS 1.11 1.09 1.10 1.10 1.76 1.25 1.48 0.67 undocumented New Protein of unknown function 1.340 -1.537 2 w118 taaCGCGAAAgct w 119 ataACGCGaaagc 1 w118 taaCGCGAAAgct 1 w 119 ataACGCGaaagc c 498 AAAAAACCGGGG glutamate biosynthesis proline oxidase S/G2 559 248 YLR142W PUT1 PUT1 YPD SGD MIPS 1.94 1.54 1.12 1.12 1.07 1.66 1.33 1.33 undocumented New "Proline oxidase, first step in synthesis of glutamate from proline " 2.486 2.760 unknown unknown G1 344 400 YLR151C YLR151C YLR151C YPD SGD MIPS 2.05 1.50 1.75 1.75 1.92 1.33 1.60 0.63 undocumented New novel 1.443 -1.631 2 c 83 cttACGCGgatcc c 136 aatACGCGattgg 2 c 83 cttACGCGgatcc c 136 aatACGCGattgg 1 w 350 TACGCCAGCATG unknown unknown G1 363 609 YLR154C YLR154C YLR154C YPD SGD MIPS 1.38 1.42 1.40 1.40 1.63 1.03 1.26 0.79 undocumented New novel 2.181 -1.784 1 w106 aaaACGCGTtag 1 w106 aaaACGCGTtag c 381 GTAATTGCGGGG unknown unknown S/G2 590 166 YLR169W YLR169W YLR169W YPD SGD MIPS 1.32 1.27 1.02 0.98 1.28 1.06 1.16 0.86 undocumented New Protein of unknown function 1.487 2.453 methionine metabolism S-adenosylmethionine synthetase S/G2 521 635 YLR180W SAM1 SAM1 YPD SGD MIPS 1.38 1.10 1.12 1.12 2.17 1.02 1.49 0.67 undocumented New S-adenosylmethionine synthetase 1 2.373 3.087 unknown unknown G1 291 540 YLR183C YLR183C YLR183C YPD SGD MIPS 9.67 5.16 7.06 7.06 3.46 1.75 2.46 0.41 undocumented New "contains a forkhead-associated (FHA) domains, which is found almost entirely among nuclear proteins" 10.310 -1.421 3 c176 aaaCACGAAAgca w230 aaaCGCGAAAaaa w 231 aaaACGCGaaaaa 1 c176 aaaCACGAAAgca 1 w230 aaaCGCGAAAaaa 1 w 231 aaaACGCGaaaaa unknown unknown G2/M 689 236 YLR190W YLR190W YLR190W YPD SGD MIPS 2.15 2.17 2.16 0.46 4.05 5.35 4.66 4.66 undocumented New novel 10.650 1.701 1 c 177 cacACGCGattct unknown unknown M/G1 92 292 YLR194C YLR194C YLR194C YPD SGD MIPS 1.30 1.75 1.51 0.66 2.97 2.94 2.95 0.34 undocumented New novel 3.997 -0.337 1 C 253 AAAGCCAGCCAT 1 c 339 gtaCACGAAAact 1 w 545 ttaACGCGTtga 1 C 253 AAAGCCAGCCAT unknown similar to human purine nucleoside phosphorylase S/G2 523 719 YLR209C YLR209C YLR209C YPD SGD MIPS 1.98 1.26 1.58 1.58 1.48 1.14 1.30 1.30 undocumented New Protein with similarity to human purine nucleoside phosphorylase 1.893 3.078 cell cycle G2/M cyclin S/G2 489 665 YLR210W CLB4 CLB4 YPD SGD MIPS 1.09 1.04 1.02 1.02 2.08 1.01 1.45 0.69 viable Known G2/M-phase-specific cyclin 3.080 -3.011 3 w211 caaACGCGTtaa w176 aaaACGCGTcgc c 172 tacACGCGACGCG 2 w211 caaACGCGTtaa w176 aaaACGCGTcgc 1 c 172 tacACGCGACGCG cytoskeleton gamma-tubulin G1 272 451 YLR212C TUB4 TUB4 YPD SGD MIPS 1.35 1.76 1.54 1.54 1.31 1.11 1.21 0.83 lethal New "Gamma tubulin, required for microtubule organization and nuclear division " 3.546 -1.349 1 w132 agaACGCGTtaa 1 w132 agaACGCGTtaa w 76 TAAACACCGGGG iron homeostasis ferric (and cupric) reductase G2/M 672 99 YLR214W FRE1 FRE1 YPD SGD MIPS 1.36 1.89 1.60 0.62 1.91 1.41 1.64 0.61 viable New "Ferric and cupric reductase, acts on ferric iron chelates external to the cell " 1.609 1.844 1 c 640 ttgCACGAAAtaa 2 w 673 GGCACCAGCTGT c 564 AATACCAGCTAA unknown unknown S/G2 535 359 YLR225C YLR225C YLR225C YPD SGD MIPS 1.22 1.13 1.18 1.18 1.36 1.27 1.31 0.76 undocumented New Protein of unknown function 1.701 3.027 1 c 521 ACCACCAGCATC unknown similar to rat kynureninase (PIR:PS0370) G1 314 313 YLR231C YLR231C YLR231C YPD SGD MIPS 1.40 1.04 1.21 0.83 1.05 1.12 1.04 0.97 undocumented New "Protein with weak similarity to rat kynureninase (PIR:PS0370), likely active in tryptophan degradation and nicotinic acid synthesis " 3.395 -1.515 1 w218 accCACGAAAata 1 w218 accCACGAAAata telomere length regulation putative end-binding protein G1 231 489 YLR233C EST1 EST1 YPD SGD MIPS 2.11 1.47 1.76 1.76 1.01 1.35 1.17 0.86 viable New Putative component of telomerase 1.331 -1.176 2 c138 gaaCGCGAAAatc c 137 tgaACGCGaaaat 1 c138 gaaCGCGAAAatc 1 c 137 tgaACGCGaaaat DNA replication DNA topoisomerase III G1 327 463 YLR234W TOP3 TOP3 YPD SGD MIPS 1.74 2.97 1.31 1.31 1.59 1.02 1.27 0.79 viable New "DNA topoisomerase III, relaxes negatively (but not positively) supercoiled DNA " 2.340 -1.571 2 w133 gaaCGCGAAAatc w 134 tgaACGCGaaaat 1 w133 gaaCGCGAAAatc 1 w 134 tgaACGCGaaaat unknown unknown G1 280 422 YLR235C YLR235C YLR235C SGD MIPS 1.45 1.56 1.04 1.04 1.47 1.31 1.39 0.72 undocumented New questionable ORF 2.436 -1.375 1 c 14 ttcACGCGcgact 1 c 14 ttcACGCGcgact unknown unknown G1 289 423 YLR236C YLR236C YLR236C YPD SGD MIPS 1.18 1.76 1.22 1.22 1.48 1.37 1.43 0.70 undocumented New hypothetical protein 1.832 -1.413 unknown unknown G2/M 764 83 YLR254C YLR254C YLR254C YPD SGD MIPS 2.40 1.01 1.54 0.65 1.91 2.64 2.24 2.24 undocumented New novel 1.905 1.052 1 c 554 aagACGCGatcgt 1 c 501 TACACCAGCAGT glucose repression (putative) Glc7p regulatory subunit M/G1 84 322 YLR273C PIG1 PIG1 YPD SGD MIPS 1.03 1.18 1.10 0.91 3.34 1.91 2.53 2.53 viable New "Protein that interacts with Gsy2p, possible regulatory subunit for the PP1 family protein phosphatase Glc7p " 2.583 -0.264 2 C 301 TATGCCAGCCTT c 387 TTTCCCTTTTAGGAAA 2 w 412 tttCGCGAAActg c 415 tttCGCGAAAtct 1 w 209 attACGCGTtta 1 C 301 TATGCCAGCCTT DNA replication MCM initiator complex M/G1 11 74 YLR274W CDC46 CDC46 YPD SGD MIPS 1.52 1.67 1.59 0.63 2.08 2.72 2.38 2.38 lethal Known aka MCM5; MCM proteins are components of the prereplication complex because association of MCM proteins with replication origins requires both Orc1p and Cdc6 function 6.751 0.385 cell wall biogenesis endochitinase G1 232 287 YLR286C CTS1 CTS1 YPD SGD MIPS 1.26 1.04 1.15 0.87 1.26 1.33 1.03 1.03 viable Known null mutant is defective in cell separation but has roughly normal level of cellular chitin 11.200 -1.187 3 w 529 ATAACCAGCCTC c 549 GGGACCAGCATT c 569 TTCACCAGCGGC 1 c 549 GGGACCAGCATT 1 c 251 TTTCCCTTTAAGGAAA DNA repair; DNA damage checkpoint activates exonuclease S/G2 490 618 YLR288C MEC3 MEC3 YPD SGD MIPS 1.09 1.02 1.04 0.97 1.61 1.05 1.24 0.81 viable New Checkpoint protein required for arrest in G2 after DNA damage and for delaying in G1- and S-phase during DNA damage 1.402 -3.011 unknown unknown G2/M 768 71 YLR297W YLR297W YLR297W YPD SGD MIPS 1.01 1.02 1.01 1.01 1.90 1.69 1.79 1.79 undocumented New Protein of unknown function 4.424 0.986 1 w 458 cgcACGCGTatt cell wall biogenesis "exo-beta-1,3-glucanase" G1 381 756 YLR300W EXG1 EXG1 YPD SGD MIPS 6.19 1.68 3.22 3.22 1.65 1.54 1.59 0.63 viable New "Exo-beta-1,3-glucanase (I/II), major isoform involved in cell wall beta-glucan assembly" 2.926 -1.944 4 w 683 gagACGCGacttc w 581 catACGCGcattg c 477 gcaACGCGcctgg c 617 gaaACGCGcagta 4 w 683 gagACGCGacttc w 581 catACGCGcattg c 477 gcaACGCGcctgg c 617 gaaACGCGcagta 1 w 665 GATGCCAGCATA unknown unknown S/G2 487 640 YLR302C YLR302C YLR302C YPD SGD MIPS 2.04 1.21 1.57 1.57 1.54 1.00 1.24 0.81 undocumented New Protein of unknown function 1.565 -3.001 methionine biosynthesis O-acetylhomoserine sulfhydrylase S/G2 491 655 YLR303W MET17 MET17 YPD SGD MIPS 3.19 1.09 1.86 1.86 1.33 1.30 1.31 0.76 viable New "O-acetylhomoserine sulfhydrylase (OAH SHLase), converts O-acetylhomoserine into homocysteine " 4.915 -3.011 "bud site selection, bipolar" interacts with MAPKKs G1 251 503 YLR313C SPH1 SPH1 YPD SGD MIPS 2.31 1.44 1.82 1.82 1.73 1.54 1.63 0.61 viable New Protein involved in schmoo formation and required for bipolar bud site selection; Spa2 homologue 4.271 -1.262 2 w163 gagACGCGTaaa w 170 aaaACGCGagacg 1 w163 gagACGCGTaaa 1 w 170 aaaACGCGagacg unknown unknown G1 390 753 YLR326W YLR326W YLR326W YPD SGD MIPS 2.96 1.88 2.36 2.36 1.40 1.06 1.22 0.82 undocumented New novel 3.358 -2.097 1 w 446 agtACGCGaatat 1 w 446 agtACGCGaatat cell wall biogenesis "1,3-beta-D-glucan synthase subunit" G1 405 779 YLR342W GLS1 FKS1 YPD SGD MIPS 5.22 2.07 3.28 3.28 2.73 1.43 1.97 0.51 viable Known "1,3-beta-D-glucan synthase" 3.281 -2.257 1 w 492 gtgACGCGatctg 1 w 492 gtgACGCGatctg unknown similar to Gas1p G1 296 725 YLR343W YLR343W YLR343W YPD SGD MIPS 1.16 1.05 1.10 1.10 1.40 1.61 1.50 0.67 viable New Protein with strong similarity to Gas1p 1.987 -1.439 nuclear protein targeting beta-karyopherin G2/M 793 254 YLR347C KAP95 KAP95 YPD SGD MIPS 1.07 1.05 1.01 0.99 1.41 1.14 1.26 0.79 lethal New "Karyopherin-beta, acts to target proteins with nuclear localization (NLS) sequences to the nuclear pore complex " 1.335 0.663 1 w 399 ATAACCAGCATT 1 w 399 ATAACCAGCATT "bud site selection, bipolar" unknown G2/M 639 212 YLR353W BUD8 BUD8 YPD SGD MIPS 1.18 1.16 1.17 1.17 2.17 1.19 1.61 1.61 viable New "Protein required for bipolar budding, has an RNA recognition (RRM) domain " 4.286 2.038 1 c 422 cttACGCGcaata fatty acid metabolism conversion of 24-carbon to 26-carbon fatty acids G1 397 759 YLR372W SUR4 SUR4 YPD SGD MIPS 2.48 1.25 1.76 1.76 2.68 1.54 2.03 0.49 undocumented New Protein required for the conversion of 24-carbon fatty acids to 26-carbon fatty acids 1.406 -2.156 3 w372 aaaCGCGAAAttt w 388 atgACGCGagaaa w 373 aaaACGCGaaatt 1 w372 aaaCGCGAAAttt 2 w 388 atgACGCGagaaa w 373 aaaACGCGaaatt unknown similar to Von Willebrand factor S/G2 494 783 YLR373C YLR373C YLR373C YPD SGD MIPS 2.16 1.78 1.96 1.96 1.32 1.16 1.24 0.81 undocumented New Protein with weak similarity to Von Willebrand factor 2.620 -3.021 2 w 686 AGGACCAGCCAC c 43 GCTGCCAGCAAA c 332 AAATATCTGGGG unknown unknown G1 412 747 YLR380W YLR380W YLR380W YPD SGD MIPS 1.73 1.56 1.64 1.64 1.69 1.12 1.38 0.73 undocumented New Protein of unknown function 1.965 -2.363 2 c241 aaaCACGAAAcaa c 340 gggACGCGatggc 1 c241 aaaCACGAAAcaa 1 c 340 gggACGCGatggc "DNA repair, recombination" unknown G1 349 502 YLR383W RHC18 RHC18 YPD SGD MIPS 1.89 1.08 1.43 1.43 1.99 1.47 1.71 0.58 undocumented New "Protein involved in recombination repair, homologous to S. pombe rad18" 3.979 -1.691 2 w176 aaaACGCGTcgc c 172 tatACGCGACGCG 1 w176 aaaACGCGTcgc 1 c 172 tatACGCGACGCG w 594 AAATCTCCGGGG unknown unknown G2/M 774 257 YLR413W YLR413W YLR413W YPD SGD MIPS 1.00 4.55 2.14 0.47 1.10 1.16 1.13 0.89 undocumented New Protein of unknown function 3.407 0.942 unknown unknown S/G2 578 689 YLR437C YLR437C YLR437C YPD SGD MIPS 1.61 1.13 1.35 1.35 1.35 1.15 1.24 0.80 undocumented New novel 1.958 2.518 2 w 327 ggcACGCGactac w 191 accACGCGctttt 2 w 327 ggcACGCGactac w 191 accACGCGctttt arginine metabolism ornithine aminotransferase G2/M 660 253 YLR438W CAR2 CAR2 YPD SGD MIPS 1.53 1.58 1.56 1.56 1.67 1.34 1.12 0.90 viable New Ornithine aminotransferase (ornithine--oxo-acid aminotransferase) 3.209 1.919 2 c 163 ggcACGCGactac c 299 accACGCGctttt w 326 AATTCGGCGGGG mating negative regulator of Gpa1 M/G1 56 308 YLR452C SST2 SST2 YPD SGD MIPS 1.12 1.16 1.14 0.88 2.03 1.28 1.26 0.79 viable Known Protein involved in desensitization to alpha-factor pheromone 2.406 -0.030 1 w 227 aaaACGCGgctgt unknown unknown S 475 686 YLR455W YLR455W YLR455W YPD SGD MIPS 1.35 1.08 1.12 1.12 1.28 1.04 1.16 0.87 undocumented New weak similarity to human G/T mismatch binding protein 4.935 -2.899 unknown Nap1p-binding protein G1 202 411 YLR457C NBP1 NBP1 YPD SGD MIPS 1.46 1.20 1.32 1.32 1.08 1.22 1.06 0.94 lethal New Nap1p-binding protein 1.639 -1.059 1 w112 gtgACGCGTcat 1 w112 gtgACGCGTcat unknown unknown G1 265 412 YLR458W YLR458W YLR458W SGD MIPS 1.01 1.22 1.10 1.10 1.30 1.02 1.13 0.89 undocumented New questionable ORF 1.456 -1.315 unknown unknown G1 139 577 YLR462W YLR462W YLR462W YPD SGD MIPS 1.96 2.50 2.21 2.21 1.29 1.74 1.16 1.16 undocumented New Protein with similarity to other subtelomerically-encoded protein (YPL283 and YGR296W code for identical proteins) 4.480 -0.659 1 w 544 ctgACGCGccata 1 w 544 ctgACGCGccata unknown similar to other subtelomerically-coded proteins M/G1 100 576 YLR463C YLR463C YLR463C YPD SGD MIPS 1.79 1.83 1.81 1.81 1.22 1.34 1.05 1.05 undocumented New Protein with similarity to other subtelomerically-encoded protein (YPL283 and YGR296W code for identical proteins) 3.808 -0.424 1 C 321 TATGCCAGCCTC 1 C 321 TATGCCAGCCTC unknown similar to other subtelomerically-coded proteins G1 122 575 YLR464W YLR464W YLR464W YPD SGD MIPS 1.22 2.09 1.31 1.31 1.75 1.53 1.07 0.93 undocumented New Protein with similarity to other subtelomerically-encoded proteins 3.986 -0.561 1 w151 tgtCACGAAAtag 1 w151 tgtCACGAAAtag unknown unknown M/G1 91 559 YLR465C YLR465C YLR465C YPD SGD MIPS 1.13 1.37 1.24 1.24 1.21 1.09 1.15 0.87 undocumented New see comment; questionable ORF 1.528 -0.327 unknown similar to other subtelomerically-coded proteins M/G1 102 599 YLR466W YLR466W YLR466W YPD SGD MIPS 1.78 1.75 1.76 1.76 1.66 1.40 1.09 0.92 undocumented New Protein with similarity to other subtelomerically-encoded proteins 3.096 -0.456 1 C 317 GTCACCAGCGCC 1 w 666 tgtCACGAAAtag 1 C 317 GTCACCAGCGCC unknown similar to other subtelomerically-encoded proteins G1 115 596 YLR467W YLR467W YLR467W YPD SGD MIPS 1.94 2.09 2.01 2.01 1.31 1.23 1.03 0.97 undocumented New Protein with similarity to other subtelomerically-encoded proteins 4.062 -0.536 1 w 590 ctgACGCGccata 1 w 590 ctgACGCGccata secretion vesicle coat component S 429 785 YML012W ERV25 ERV25 YPD SGD MIPS 1.98 1.22 1.27 1.27 1.77 1.09 1.27 0.79 viable New Component of the COPII coat of certain ER-derived vesicles 2.164 -2.478 1 w 187 caaACGCGTaca 1 w 187 caaACGCGTaca unknown unknown G1 266 389 YML020W YML020W YML020W YPD SGD MIPS 1.67 1.02 1.28 1.28 1.10 1.35 1.22 0.82 undocumented New Protein of unknown function 1.508 -1.315 1 w283 attACGCGTtgc 1 w283 attACGCGTtgc DNA repair uracil DNA glycosylase G1 343 511 YML021C UNG1 UNG1 YPD SGD MIPS viable Known "Uracil-DNA glycolyase, removes uracil from DNA " 1.452 -1.631 1 w 64 gcaACGCGTaat 1 w 64 gcaACGCGTaat unknown binds leu-tRNA gene G1 276 537 YML027W YOX1 YOX1 YPD SGD MIPS 7.26 4.05 5.42 5.42 4.63 2.78 3.59 0.28 viable New Homeodomain protein that binds leu-tRNA gene 7.835 -1.364 3 w500 aaaACGCGTaaa w 439 gagACGCGacgct w 234 caaACGCGaacaa 1 w500 aaaACGCGTaaa 2 w 439 gagACGCGacgct w 234 caaACGCGaacaa unknown unknown G2/M 638 228 YML033W YML033W YML033W YPD SGD MIPS 1.07 1.16 1.11 0.90 1.80 1.85 1.82 1.82 undocumented New has weak similarity to Ydr458p 6.421 2.039 w 631 TATTCGGCGGGG unknown unknown G2/M 628 229 YML034W YML034W YML034W YPD SGD MIPS 1.25 1.05 1.15 1.15 1.43 2.60 1.93 1.93 undocumented New has weak similarity to Ydr458p 7.306 2.120 c 423 ATTAACCTGGGG unknown unknown G2/M 662 178 YML035C-A YML035C-A SGD undocumented New 1.509 1.897 unknown similar to potato sucrose cleavage protein G2/M 761 63 YML050W YML050W YML050W YPD SGD MIPS 1.20 1.41 1.30 0.77 2.42 1.25 1.74 0.57 undocumented New Protein with weak similarity to potato sucrose cleavage protein 1.515 1.086 1 c 105 atgCACGAAAaag endocytosis (putative) suppresses rvs167 mutation G2/M 636 155 YML052W SUR7 SUR7 YPD SGD MIPS viable New Multicopy suppressor of rvs167 mutation 5.674 2.061 unknown unknown S/G2 596 147 YML058W YML058W SML1 YPD SGD MIPS 1.78 1.96 1.87 0.53 1.30 1.03 1.12 0.89 viable New Suppressor of mec lethality 7.896 2.394 DNA repair 8-oxoguanine DNA glycosylase G1 261 465 YML060W OGG1 OGG1 YPD SGD MIPS 2.53 1.20 1.74 1.74 1.73 1.35 1.53 0.65 viable New "DNA glycosylase, excises 7,8-dihydro-8-oxoguanine (8-OxoG) and Fapy residues from DNA" 2.915 -1.300 1 w 135 aagACGCGccttt 1 w 135 aagACGCGccttt "DNA repair, mitochondrial" DNA helicase G1 342 466 YML061C PIF1 PIF1 YPD SGD MIPS 1.47 1.71 1.59 1.59 2.13 1.26 1.64 0.61 viable New "Single-stranded DNA-dependent ATPase and 5'-3' DNA helicase required for maintenance and repair of mitochondrial DNA, also functions in nucleus to regulate telomere length " 2.254 -1.631 1 c 216 aagACGCGccttt 1 c 216 aagACGCGccttt 2 w 413 TTGGCCAGCCTG c 480 TAGGCCAGCAAG 1 c 480 TAGGCCAGCAAG c 114 AATAGACTGGGG cell cycle "GTP-binding protein, RAS superfamily" G2/M 714 222 YML064C TEM1 TEM1 YPD SGD MIPS 1.57 1.01 1.25 0.80 2.45 2.09 2.26 2.26 lethal New GTP-binding protein of the ras superfamily involved in termination of M-phase 3.180 1.564 1 c 364 aggACGCGgtaga w 258 AAATATCTGGGG DNA replication origin recognition complex 104 kD subunit S/G2 561 664 YML065W ORC1 ORC1 YPD SGD MIPS 1.01 1.01 1.01 1.01 1.66 1.23 1.16 0.86 lethal New "Origin recognition complex, large subunit" 1.553 2.741 unknown unknown G2/M 702 37 YML066C YML066C YML066C YPD SGD MIPS 1.14 1.67 1.21 1.21 1.45 1.03 1.19 0.84 undocumented New Protein of unknown function 1.998 1.621 unknown unknown S/G2 585 149 YML072C YML072C YML072C YPD SGD MIPS 1.21 1.36 1.28 1.28 1.56 1.08 1.20 0.83 undocumented New similarity to YOR086C and YNL087w 2.319 2.475 1 w 303 TTCGCCAGCGCG c 634 AAACATGTGGGG unknown unknown G1 142 342 YML100W TSL1 TSL1 YPD SGD MIPS 1.97 4.31 2.91 2.91 1.78 1.14 1.25 0.80 undocumented New "Component of the trehalose-6-phosphate synthase/phosphatase complex, alternate third subunit with Tps3p " 1.464 -0.673 2 c 398 tgaACGCGatttt c 527 cccACGCGcacaa 2 c 398 tgaACGCGatttt c 527 cccACGCGcacaa 1 c 272 CCCGCCAGCCGG c 569 TTTGAACTGGGG chromatin structure chromatin assembly factor I subunit G1 191 492 YML102W CAC2 CAC2 YPD SGD MIPS 1.99 2.03 2.01 2.01 1.02 1.28 1.12 0.89 viable New "Chromatin assembly complex subunit 1, involved in nucleosome assembly linked with DNA replication, has WD (WD-40) repeats" 3.078 -0.986 cell cycle Zds1 homolog G1 378 462 YML109W ZDS2 ZDS2 YPD SGD MIPS 1.08 2.12 1.51 1.51 2.32 1.54 1.89 0.53 viable New Multicopy suppressor of sin4 2.075 -1.921 2 w183 ctgACGCGTtgt c 161 aagACGCGgcgtg 1 w183 ctgACGCGTtgt 1 c 161 aagACGCGgcgtg ubiquinone biosynthesis methyltransferase M/G1 58 325 YML110C DBI56 DBI56 YPD SGD MIPS 2.05 1.85 1.95 0.51 1.72 1.76 1.01 1.01 viable New Potential mitochondrial C-methyltransferase of the ubiquinone biosynthetic pathway 1.671 -0.070 1 w 514 acaACGCGTcag 1 w 537 aagACGCGgcgtg aminotriazole resistance transporter (putative) G2/M 676 164 YML116W ATR1 ATR1 YPD SGD MIPS 1.33 1.61 1.46 0.68 1.03 1.28 1.15 1.15 viable New "Aminotriazole and 4-nitroquinoline-1-oxide (4NQO) resistance protein, member of major facilitator superfamily (MFS) multidrug-resistance (MFS-MDR) protein family " 1.569 1.814 unknown unknown S 428 360 YML117W YML117W YML117W YPD SGD MIPS 1.33 1.39 1.36 1.36 1.74 1.27 1.48 0.67 undocumented New "Protein of unknown function, contains an ATP/GTP-binding site motif A (P-loop)" 1.430 -2.470 1 w 592 gacACGCGTcag 1 w 592 gacACGCGTcag unknown unknown G2/M 707 235 YML119W YML119W YML119W YPD SGD MIPS 1.25 1.02 1.11 0.90 10.93 4.64 7.12 7.12 undocumented New "low similarity to MSS1, a protein involved in starch metabolism" 8.303 1.601 oxidative phosphorylation NADH-ubiquinone-6 oxidoreductase G2/M 622 128 YML120C NDI1 NDI1 YPD SGD MIPS 1.73 1.10 1.25 0.80 1.17 1.27 1.04 1.04 undocumented New NADH-ubiquinone oxidoreductase (rotenone insensitive) 1.447 2.168 transport inorganic phosphate permease G2/M 641 140 YML123C PHO84 PHO84 YPD SGD MIPS 1.09 2.27 1.57 0.64 1.26 1.52 1.10 0.91 viable New "High-affinity inorganic phosphate/H+ symporter, member of sugar permease family " 1.787 2.017 c 165 AATAAAGTGGGG unknown similar to NADH-cytochrome b5 reductase S/G2 560 661 YML125C YML125C YML125C YPD SGD MIPS 1.74 1.64 1.03 1.03 1.46 1.10 1.27 0.79 undocumented New Protein with similarity to NADH-cytochrome b5 reductase 2.811 2.750 1 c 17 ttcACGCGgttct 1 c 17 ttcACGCGgttct unknown similar to other subtelomerically-encoded proteins G1 146 517 YML133C YML133C YML133C YPD SGD MIPS undocumented New "Protein with similarity to other subtelomerically-encoded proteins including Yer189p, and Yjl225p " 2.287 -0.699 1 w 571 ctgACGCGccat 1 w 571 ctgACGCGccat w 296 TATTCGGCGGGG cell cycle G2/M protein kinase G2/M 647 240 YMR001C CDC5 CDC5 YPD SGD MIPS 1.39 1.09 1.23 0.81 3.35 5.32 4.22 4.22 lethal Known "Serine/threonine protein kinase of the polo family of protein kinases, required for exit from mitosis and may be involved in operation of the mitotic spindle" 9.901 1.973 1 CAAAACAAACCCAATAAAGAAAATCCAAAATATAGAAC 1 CAAAACAAACCCAATAAAGAAAATCCAAAATATAGAAC unknown unknown S/G2 581 116 YMR002W YMR002W YMR002W YPD SGD MIPS 1.12 1.06 1.09 0.92 1.22 1.20 1.01 0.99 undocumented New similarity to hypothetical S.pombe and C.elegans proteins 2.265 2.486 1 c 306 GACGCCAGCATA unknown unknown S/G2 526 684 YMR003W YMR003W YMR003W YPD SGD MIPS 1.06 1.59 1.30 1.30 1.91 1.03 1.40 0.71 undocumented New novel 5.082 3.071 1 w 567 tagACGCGagaaa 1 w 567 tagACGCGagaaa 1 w 597 CGGACCAGCAGT 1 w 597 CGGACCAGCAGT w 289 ATTAACCTGGGG transport hexose permease M/G1 57 11 YMR011W HXT2 HXT2 YPD SGD MIPS 2.24 1.52 1.84 0.54 2.10 2.13 2.12 0.47 viable New "High-affinity hexose transporter, member of sugar permease family " 4.637 -0.060 1 w 379 cctACGCGTttt sterol metabolism C-22 sterol desaturase G2/M 619 142 YMR015C ERG5 ERG5 YPD SGD MIPS 2.08 1.41 1.22 1.22 1.09 1.08 1.01 1.01 viable New Cytochrome P450 (C-22 sterol desaturase) 2.046 2.178 unknown unknown G2/M 748 81 YMR031C YMR031C YMR031C YPD SGD MIPS 3.51 1.85 2.55 0.39 2.21 2.69 2.44 2.44 undocumented New "similarity to YKL050c and human restin, has potential coiled-coil region (GB:Z49213)" 6.658 1.243 1 c 456 AAAGCCAGCTAG cytokinesis unknown G2/M 693 234 YMR032W CYK2 HOF1 YPD SGD MIPS 2.41 1.03 1.58 0.63 4.63 1.98 3.03 3.03 undocumented New "has potential coiled-coil region, and is involved in cytokinesis" 10.970 1.691 1 w 110 AAAGCCAGCTAG unknown unknown G1 229 413 YMR048W YMR048W YMR048W YPD SGD MIPS 1.69 1.01 1.31 1.31 1.08 1.10 1.01 1.01 undocumented New Protein of unknown function 1.846 -1.170 1 w75 ctgACGCGTaac 1 w75 ctgACGCGTaac 1 w 596 GGAACCAGCAGA 1 w 596 GGAACCAGCAGA "cell cycle, checkpoint" unknown S/G2 548 659 YMR055C BUB2 BUB2 YPD SGD MIPS 1.09 1.18 1.13 1.13 1.80 1.13 1.26 0.79 viable New Checkpoint protein required for cell cycle arrest in response to loss of microtubule function 1.433 2.892 1 c 416 aatACGCGccctc 1 c 416 aatACGCGccctc 1 c 359 GACACCAGCTGC transport cell surface ferroxidase G2/M 710 131 YMR058W FET3 FET3 YPD SGD MIPS 1.19 2.08 1.32 0.76 1.16 1.29 1.22 1.22 viable New Cell surface ferroxidase required for high-affinity ferrous iron uptake 4.742 1.591 "mitosis, sister chromatid cohesion" unknown G1 257 443 YMR076C PDS5 SGD MIPS 1.58 1.92 1.10 0.91 3.14 2.78 2.95 0.34 undocumented New similar to A. nidulans bimD protein 2.000 -1.287 3 c633 gacCACGAAAcct w171 gcgACGCGTaaa w 176 gcgACGCGACGCG 1 c633 gacCACGAAAcct 1 w171 gcgACGCGTaaa 1 w 176 gcgACGCGACGCG "mitosis, chromosome transmission" unknown G1 192 445 YMR078C CTF18 CTF18 YPD SGD MIPS 2.82 1.89 1.22 1.22 2.35 1.72 2.01 0.50 viable New "Homolog of Rfc1p, Rfc2p, Rfc3p, Rfc4p, and Rfc5p, required for accurate chromosome transmission in mitosis and maintenance of normal telomere length" 2.548 -0.991 1 c 109 acaACGCGactgg 1 c 109 acaACGCGactgg 2 w 563 GAAACCAGCGTC c 222 TTGACCAGCGCC 2 w 563 GAAACCAGCGTC c 222 TTGACCAGCGCC unknown unknown S 433 774 YMR144W YMR144W YMR144W YPD SGD MIPS 2.58 2.01 2.28 2.28 1.02 1.07 1.04 1.04 undocumented New weak similarity to Mlp1p 1.756 -2.492 2 w 210 tgaCGCGAAAtcg w 211 ttgACGCGaaatc 1 w 210 tgaCGCGAAAtcg 1 w 211 ttgACGCGaaatc unknown similar to rotenone-insensitive NADH-ubiquinone G2/M 649 118 YMR145C YMR145C YMR145C YPD SGD MIPS 1.90 2.56 2.21 0.45 1.40 1.02 1.20 0.84 undocumented New Protein with similarity to rotenone-insensitive NADH-ubiquinone oxidoreductase Ndi1p; has 44% identity with Ndi1p over 469 amino acids; even stronger homology to YDL085w 3.228 1.973 unknown unknown S/G2 514 671 YMR163C YMR163C YMR163C YPD SGD MIPS 1.22 1.05 1.08 0.93 1.74 1.06 1.36 0.74 undocumented New novel 2.020 3.124 1 c 322 gacCACGAAAcca 1 c 322 gacCACGAAAcca 1 w 433 CTGGCCAGCTAA transcription transcriptional regulator G1 175 499 YMR179W SPT21 SPT21 YPD SGD MIPS 3.06 1.90 2.41 2.41 1.53 1.37 1.45 0.69 viable New "required for transcription at HTA2-HTB2 and HHF2-HHT2, but not at the other two histone loci" 6.183 -0.872 4 c264 tatCACGAAAaaa w237 aaaACGCGTcgc c 233 ctaACGCGACGCG c 275 aaaACGCGaccgt 1 c264 tatCACGAAAaaa 1 w237 aaaACGCGTcgc 2 c 233 ctaACGCGACGCG c 275 aaaACGCGaccgt 1 w 344 CAAACCAGCAAA 1 w 344 CAAACCAGCAAA secretion post-Golgi t-SNARE S/G2 577 243 YMR183C SSO2 SSO2 YPD SGD MIPS 1.10 1.27 1.07 0.93 1.09 1.34 1.11 1.11 viable New Syntaxin homolog (t-SNARE) involved in vesicle transport from Golgi to plasma membrane 1.783 2.519 1 c 336 tagACGCGcatct 1 c 336 tagACGCGcatct 1 w 290 GAAGCCAGCTAA amino acid metabolism glycine decarboxylase P subunit G2/M 642 114 YMR189W GSD2 GCV2 YPD SGD MIPS 1.39 1.24 1.31 0.76 1.56 1.18 1.15 0.87 undocumented New "Glycine decarboxylase, pyridoxal phosphate containing subunit (glycine decarboxylase P subunit)" 2.720 2.006 cytoskeleton spindle pole body associated protein S/G2 528 670 YMR198W CIK1 CIK1 YPD SGD MIPS 1.47 1.23 1.09 1.09 1.10 1.54 1.30 1.30 viable Known Coiled-coil protein of spindle pole body involved in spindle formation and the congression (nuclear migration) step of karyogamy 3.553 3.055 1 c 700 taaACGCGaaata 1 c 700 taaACGCGaaata 1 w 686 ACCACCAGCGGC cell cycle G1/S cyclin G1 304 476 YMR199W CLN1 CLN1 YPD SGD MIPS 1.89 2.25 2.06 2.06 4.95 2.50 3.52 0.28 viable Known G1 cyclin 5.364 -1.475 3 w500 aatCGCGAAAaaa w 686 caaACGCGgcaag c 375 gaaACGCGcacgc 1 w500 aatCGCGAAAaaa 2 w 686 caaACGCGgcaag c 375 gaaACGCGcacgc sterol metabolism C-8 sterol isomerase G2/M 650 141 YMR202W ERG2 ERG2 YPD SGD MIPS 1.55 1.54 1.00 1.00 1.07 1.49 1.26 0.79 viable New "Sterol C8-C7 isomerase (C-8 sterol isomerase), enzyme of the ergosterol biosynthesis pathway " 1.645 1.972 unknown similar to Gas1p S/G2 517 714 YMR215W YMR215W YMR215W YPD SGD MIPS 1.99 1.12 1.33 1.33 2.57 1.33 1.85 0.54 viable New has 43% identity over 241 amino acids with Gas1p 5.652 3.109 1 c 175 gcgCGCGAAAaaa w 296 TATTCGGCGGGG pseudohyphal growth unknown S 465 775 YMR238W DFG5 DFG5 YPD SGD MIPS 2.08 1.29 1.64 1.64 1.98 1.64 1.80 0.56 viable New "Protein required for filamentous growth, cell polarity, and cellular elongation " 3.108 -2.813 1 c 212 tttACGCGgatta 1 c 212 tttACGCGgatta w 119 CCCAATGTAGAAAAGTACATCATATGAAACA fatty acid metabolism long-chain-fatty-acid--CoA ligase M/G1 14 259 YMR246W FAA4 FAA4 YPD SGD MIPS 1.27 1.69 1.15 0.87 1.14 1.07 1.03 0.97 viable New "Acyl-CoA synthase (long-chain fatty acid CoA ligase), contributes to activation of imported myristate " 1.561 0.342 2 w 77 AGAACCAGCATT w 77 AGAACCAGCATT 1 c 491 aagACGCGcagcc 1 w 77 AGAACCAGCATT 1 w 77 AGAACCAGCATT unknown major facilitator superfamily G2/M 734 33 YMR253C YMR253C YMR253C YPD SGD MIPS 1.85 1.04 1.33 1.33 1.20 1.35 1.06 1.06 undocumented New "Protein of unknown function, member of the major facilitator superfamily (MFS) " 2.062 1.380 1 w 353 CAAGCCAGCAAG 1 w 353 CAAGCCAGCAAG unknown unknown G2/M 753 176 YMR254C YMR254C YMR254C YPD SGD MIPS viable New "Protein of unknown function, questionable ORF " 1.544 1.121 1 c 267 aacCACGAAAgta 1 c 267 aacCACGAAAgta unknown similar to phosphomannomutase S/G2 547 355 YMR278W YMR278W YMR278W YPD SGD MIPS 1.75 1.28 1.17 0.86 2.03 1.13 1.34 0.75 undocumented New Protein with simiarity to phosphomannomutase 1.330 2.926 1 c 596 AGTACCAGCAGC unknown unknown S 416 631 YMR295C YMR295C YMR295C YPD SGD MIPS 1.48 1.27 1.37 1.37 1.33 1.43 1.38 0.73 undocumented New similarity to YGR273c 1.619 -2.377 1 c 108 tacCACGAAAgta 1 c 108 tacCACGAAAgta unknown similar to Bgl2p and other glucans (GB:Z49212) G1 339 478 YMR305C YMR305C YMR305C YPD SGD MIPS 2.25 1.45 1.81 1.81 3.93 3.57 3.75 0.27 undocumented New Protein with similarity to Bgl2p and other glucans 3.824 -1.611 5 w505 tttCGCGAAAgac w405 ttgCGCGAAAcag c508 tttCGCGAAAtct w346 cgcACGCGTttg c 384 tcaACGCGaattt 3 w505 tttCGCGAAAgac w405 ttgCGCGAAAcag c508 tttCGCGAAAtct 1 w346 cgcACGCGTttg 1 c 384 tcaACGCGaattt w 445 AATTATCCGGGG unknown cell surface glycoprotein G1 407 767 YMR307W GAS1 GAS1 YPD SGD MIPS 3.60 2.03 2.70 2.70 2.12 2.17 2.14 0.47 viable Known Glycophospholipid-anchored surface glycoprotein 2.641 -2.263 5 c505 aaaCGCGAAAatt w640 gtaACGCGTtat w586 ttaACGCGTcct w 439 tttACGCGcacaa c 504 aaaACGCGaaaat 1 c505 aaaCGCGAAAatt 2 w640 gtaACGCGTtat w586 ttaACGCGTcct 2 w 439 tttACGCGcacaa c 504 aaaACGCGaaaat mitochondrial protein targeting mitochondrial carrier family S/G2 555 657 YNL003C PET8 PET8 YPD SGD MIPS 1.68 1.45 1.56 0.64 1.60 1.11 1.20 0.83 viable New "Protein of the mitochondrial carrier (MCF) family, has similarity to Mrs4p and Mrs3p " 1.526 2.803 1 w 644 cctCACGAAAtag 1 w 644 cctCACGAAAtag unknown protease inhibitor G1 246 343 YNL015W PBI2 PBI2 YPD SGD MIPS 1.33 2.20 1.71 1.71 2.27 1.37 1.76 0.57 viable New "Protease B (yscB or Prb1p) inhibitor 2 (I2B), has activity related to vacuolar fusion that is not related to protease activity " 3.064 -1.249 chromatin structure histone H4 S 418 792 YNL030W HHF2 HHF2 YPD SGD MIPS 3.22 2.88 3.04 3.04 1.98 1.79 1.88 0.53 viable Known Histone H4 (HHF1 and HHF2 code for identical proteins) 9.744 -2.399 chromatin structure histone H3 S 430 793 YNL031C HHT2 HHT2 YPD SGD MIPS 2.95 2.45 2.69 2.69 1.55 1.33 1.44 0.69 viable Known Histone H3 (HHT1 and HHT2 code for identical proteins) 8.063 -2.478 w 636 TATTCGGCGGGG TCA cycle isocitrate dehydrogenase G2/M 606 119 YNL037C IDH1 IDH1 YPD SGD MIPS 1.24 1.49 1.36 0.74 1.32 1.01 1.16 0.86 viable New "Isocitrate dehydrogenase (NAD+) subunit 1, mitochondrial, required for oxidative function of the tricarboxylic acid cycle " 2.259 2.307 unknown unknown S/G2 510 705 YNL043C YNL043C YNL043C YPD SGD MIPS 1.32 1.05 1.18 0.85 2.30 1.09 1.45 0.69 undocumented New novel; questionable ORF 1.850 3.130 unknown unknown M/G1 39 271 YNL046W YNL046W YNL046W YPD SGD MIPS 2.25 1.13 1.41 0.71 1.45 1.27 1.36 0.74 undocumented New novel 2.171 0.110 2 c 102 CGAGCCAGCATT C 102 CGAGCCAGCATT 1 C 102 CGAGCCAGCATT 1 c 102 CGAGCCAGCATT unknown unknown G2/M 745 171 YNL056W YNL056W YNL056W YPD SGD MIPS 1.02 1.01 1.01 1.01 1.02 1.01 1.02 0.98 undocumented New Protein of unknown function 1.534 1.278 1 c 355 CCTAAAGCGGGAAATAGTAAACAT 1 c 355 CCTAAAGCGGGAAATAGTAAACAT 1 w 576 CTGACCAGCGAT 1 w 576 CTGACCAGCGAT unknown unknown G2/M 752 206 YNL057W YNL057W YNL057W YPD SGD MIPS 1.04 1.00 1.02 1.02 1.51 2.75 2.04 2.04 undocumented New novel; questionable ORF 4.955 1.193 c 389 CTAAATCTGGGG unknown unknown G2/M 737 223 YNL058C YNL058C YNL058C YPD SGD MIPS 1.44 1.10 1.14 0.87 2.65 1.84 2.21 2.21 undocumented New has similarity to Yil117p 9.392 1.344 1 w 204 CCTAAAGCGGGAAATAGTAAACAT 1 w 204 CCTAAAGCGGGAAATAGTAAACAT DNA replication (putative) ribonuclease H G1 185 518 YNL072W RNH35 RNH35 YPD SGD MIPS 1.67 2.35 1.98 1.98 2.01 1.16 1.53 0.65 viable New RNase H of 35 kDa 1.579 -0.952 2 w96 ctaCGCGAAAaat w 97 gctACGCGaaaaa 1 w96 ctaCGCGAAAaat 1 w 97 gctACGCGaaaaa c 543 AAACTTCTGGGG unknown unknown M/G1 38 266 YNL078W YNL078W YNL078W YPD SGD MIPS 2.38 1.01 1.54 0.65 1.12 1.56 1.32 0.76 undocumented New has 5 potential transmembrane domains 7.368 0.138 1 C 357 CAAACCAGCCAT 1 w 365 gccACGCGatggc 1 C 357 CAAACCAGCCAT DNA repair MutL homolog; mismatch repair G1 160 557 YNL082W PMS1 PMS1 YPD SGD MIPS 1.80 1.79 1.80 1.80 1.77 1.23 1.48 0.68 undocumented Known "Protein required for mismatch repair, homologous to E. coli MutL " 4.843 -0.777 6 w658 cgtCACGAAAaaa w601 tgtCACGAAAagt w467 attCACGAAAtaa w435 atcCACGAAAatc w252 aacCACGAAAagt w401 tatCGCGAAAatt 5 w658 cgtCACGAAAaaa w601 tgtCACGAAAagt w467 attCACGAAAtaa w435 atcCACGAAAatc w252 aacCACGAAAagt 1 w401 tatCGCGAAAatt DNA replication polymerase alpha 180 kD subunit G1 199 415 YNL102W POL1 POL1 YPD SGD MIPS 2.36 1.72 2.01 2.01 2.24 1.13 1.60 0.63 lethal Known DNA polymerase alpha 180 kDa subunit 3.143 -1.024 5 w373 taaCACGAAAaat w396 tgaCGCGAAAagt w 580 gagACGCGaagcc w 397 atgACGCGaaaag c 382 gttACGCGaagtc 1 w373 taaCACGAAAaat 1 w396 tgaCGCGAAAagt 3 w 580 gagACGCGaagcc w 397 atgACGCGaaaag c 382 gttACGCGaagtc 4 w 529 AATGCCAGCTGA w 476 AAAACCAGCAGA w 450 ATGGCCAGCTAT c 363 TGCACCAGCATT 1 w 476 AAAACCAGCAGA lipid metabolism cytochrome b5 G2/M 685 139 YNL111C CYB5 CYB5 YPD SGD MIPS 1.08 1.10 1.01 1.01 1.36 1.29 1.03 0.98 viable New Cytochrome b5 1.456 1.721 cytoskeleton spindle pole body component G1 391 733 YNL126W SPC98 SPC98 YPD SGD MIPS 2.62 1.29 1.84 1.84 1.70 1.25 1.46 0.69 lethal New Spindle pole body component that interacts with gamma-tubulin 2.570 -2.111 1 c 149 caaACGCGacgca 1 c 149 caaACGCGacgca 1 w 453 TTTCCCGTTTAGGAAA unknown similar to C. carbonum toxD gene M/G1 19 331 YNL134C YNL134C YNL134C YPD SGD MIPS 1.43 1.47 1.45 0.69 1.30 1.10 1.19 0.84 undocumented New Protein with similarity to C. carbonum toxD gene 2.140 0.314 1 c 382 ttcCACGAAAtgg mating a-factor precursor G2/M 783 57 YNL145W MFA2 MFA2 YPD SGD MIPS 5.12 5.26 5.19 0.19 1.76 5.89 3.22 3.22 viable Known a-factor 3.364 0.812 1 c 221 TTACCCAATTAGGAAA 1 diauxic shift unknown; response to nutrient limitation M/G1 6 69 YNL160W YGP1 YGP1 YPD SGD MIPS 8.11 5.00 6.37 0.16 6.38 4.79 5.53 5.53 undocumented New Secreted glycoprotein produced in response to nutrient limitation 9.334 0.496 unknown unknown G1 358 459 YNL165W YNL165W YNL165W YPD SGD MIPS 1.26 1.18 1.22 1.22 2.45 1.18 1.70 0.59 undocumented New weak similarity to YMR316W and YOR385W 1.989 -1.743 1 w147 ataACGCGTcta 1 w147 ataACGCGTcta unknown unknown G1 393 768 YNL166C YNL166C YNL166C YPD SGD MIPS 3.06 1.48 2.13 2.13 1.76 1.32 1.52 0.66 undocumented New novel 1.780 -2.111 1 w131 tagACGCGTtat 1 w131 tagACGCGTtat phospholipid metabolism phosphatidylserine decarboxylase G1 337 552 YNL169C PSD1 PSD1 YPD SGD MIPS 1.32 1.09 1.20 1.20 1.83 1.12 1.28 0.78 viable New "Phosphatidylserine decarboxylase, mitochondrial isozyme, converts phosphatidyl-L-serine to phosphatidylethanolamine " 1.351 -1.611 1 w 230 GTAACCAGCACC 1 w 230 GTAACCAGCACC unknown unknown G2/M 625 172 YNL171C YNL171C YNL171C YPD SGD MIPS 1.91 1.01 1.39 0.72 1.78 1.22 1.21 0.83 undocumented New "Protein of unknown function, questionable ORF " 1.466 2.143 1 mitosis anaphase-promoting complex subunit G2/M 629 211 YNL172W APC1 APC1 YPD SGD MIPS 1.45 1.37 1.03 0.97 1.01 1.10 1.05 1.05 lethal New "Component of the anaphase-promoting complex (APC), required for Clb2p degradation and for the metaphase-anaphase transition " 1.721 2.119 1 w 314 AAGGCCAGCCTC "signaling, pheromone pathway" unknown M/G1 80 333 YNL173C MDG1 MDG1 YPD SGD MIPS 1.25 1.49 1.37 0.73 1.74 1.21 1.20 0.83 undocumented New G-protein involved in adaptation to pheromone response 1.521 -0.243 1 C 276 AAGGCCAGCCTC 1 C 276 AAGGCCAGCCTC unknown unknown S/G2 539 701 YNL176C YNL176C YNL176C YPD SGD MIPS 2.06 1.05 1.40 1.40 1.35 1.41 1.38 0.73 undocumented New Protein of unknown function 2.213 2.994 unknown unknown G1 286 455 YNL181W YNL181W YNL181W YPD SGD MIPS 1.72 1.59 1.65 1.65 1.90 1.04 1.41 0.71 undocumented New Protein of unknown function 1.755 -1.400 3 w 165 tagACGCGatcga c 189 gaaACGCGggcac c 557 tgtACGCGcgaac 3 w 165 tagACGCGatcga c 189 gaaACGCGggcac c 557 tgtACGCGcgaac cytokinesis chitin synthase M/G1 16 273 YNL192W CHS1 CHS1 YPD SGD MIPS 1.45 1.25 1.35 1.35 1.51 1.28 1.39 0.72 viable Known chitin synthase I 2.748 0.329 2 w 286 gtaACGCGataat c 302 gccACGCGatttc cell size unknown S/G2 500 702 YNL197C WHI3 WHI3 YPD SGD MIPS 2.31 1.37 1.78 1.78 1.36 1.12 1.10 0.91 viable New "Protein involved in regulation of cell size, has 1 RNA recognition (RRM) domain " 1.691 -3.101 1 c 494 ttaACGCGggtaa 1 c 494 ttaACGCGggtaa 1 w 151 TTCACCAGCTTT unknown unknown G1 395 351 YNL208W YNL208W YNL208W YPD SGD MIPS 1.44 1.04 1.18 0.85 1.38 1.39 1.38 0.72 undocumented New Protein of unknown function 1.356 -2.134 1 c 134 ACAGCCAGCCCC transcription transcriptional repressor and activator S/G2 497 743 YNL216W RAP1 RAP1 YPD SGD MIPS 1.65 1.29 1.46 1.46 1.07 1.17 1.12 0.89 lethal New "DNA-binding protein with repressor and activator activity, also involved in silencing at telomeres and silent mating type loci" 1.622 -3.091 cytoskeleton spindle pole body component G1 230 450 YNL225C CNM67 CNM67 YPD SGD MIPS 1.90 1.23 1.53 1.53 1.82 1.16 1.46 0.69 viable New Protein involved in nuclear migration 1.670 -1.174 1 c 150 gcaACGCGaattt 1 c 150 gcaACGCGaattt drug resistance unknown G1 233 604 YNL231C YNL231C PDR16 YPD SGD MIPS 2.91 1.36 1.99 1.99 2.29 1.92 2.10 0.48 undocumented New Protein with weak similarity to Sec14p and Ylr380p 1.335 -1.188 2 c372 caaCGCGAAAatc c 364 atgACGCGcaacg 1 c372 caaCGCGAAAatc 1 c 364 atgACGCGcaacg cytokinesis may link chitin synthase to septins G1 174 543 YNL233W BNI4 BNI4 YPD SGD MIPS 2.00 1.98 1.99 1.99 2.56 1.47 1.94 0.52 viable New Protein that may be involved in linking chitin synthase III to septins of the neck filaments 3.001 -0.866 2 w292 gagACGCGTcaa c 307 ctgACGCGcctat 1 w292 gagACGCGTcaa 1 c 307 ctgACGCGcctat DNA replication polymerase epsilon catalytic subunit G1 297 481 YNL262W POL2 POL2 YPD SGD MIPS 1.30 2.52 1.81 1.81 1.86 1.20 1.49 0.67 lethal Known DNA polymerase epsilon large subunit 5.436 -1.440 2 w199 taaACGCGTgag w179 gatACGCGTctc 2 w199 taaACGCGTgag w179 gatACGCGTctc w 503 CCCAAAAGGGAAAGGCTCGCTCTGAAACA w 454 AGAATCGTGGGG unknown interacts with Yip1p; similar to NADH dehydrogenases G1 382 758 YNL263C SIF1 YIF1 YPD SGD MIPS 1.98 2.02 2.00 2.00 1.76 1.12 1.41 0.71 lethal New Protein with similarity to NADH dehydrogenases 1.897 -1.953 2 w265 cttACGCGTtct w 601 cctACGCGgcctg 1 w265 cttACGCGTtct 1 w 601 cctACGCGgcctg 2 w 634 GAGACCAGCGTT w 434 GTTGCCAGCTGA 1 w 634 GAGACCAGCGTT unknown topoisomerase I interacting factor G1 182 501 YNL273W TOF1 TOF1 YPD SGD MIPS 1.02 1.28 1.12 1.12 2.70 1.01 1.63 0.61 viable New Topoisomerase I interacting factor 1.978 -0.938 2 w158 ttgACGCGTtta w139 attACGCGTtta 2 w158 ttgACGCGTtta w139 attACGCGTtta 1 c 333 AAAACCAGCGTT 1 c 333 AAAACCAGCGTT unknown unknown S/G2 492 653 YNL276C YNL276C YNL276C YPD SGD MIPS 1.44 1.50 1.47 1.47 1.38 1.03 1.16 0.86 viable New "Protein of unknown function, questionable ORF " 1.605 -3.011 1 w 439 CTTGCCAGCGCT cell wall biogenesis "alpha-1,4-glucan-glucosidase" S 455 777 YNL283C WSC2 WSC2 YPD SGD MIPS 2.94 2.14 2.51 2.51 2.94 1.23 1.90 0.53 viable New Protein required for maintenence of cell wall integrity and for the stress response; similar to WSC4 6.217 -2.660 3 c 605 cacCGCGAAAaaa c 633 aaaCGCGAAAtgt c 632 aaaACGCGaaatg 2 c 605 cacCGCGAAAaaa c 633 aaaCGCGAAAtgt 1 c 632 aaaACGCGaaatg 1 w 690 ACAGCCAGCTAG cell cycle G1/S cyclin G1 288 421 YNL289W PCL1 PCL1 YPD SGD MIPS 1.38 1.13 1.11 0.90 1.56 1.03 1.23 0.81 viable Known G1/S-specific cyclin that can interact with the Cdc28p-like kinase Pho85p 2.552 -1.410 2 w169 attACGCGTaac c 642 ggtACGCGgttag 1 w169 attACGCGTaac 1 c 642 ggtACGCGgttag 1 w 626 TCCGCCAGCCAT unknown similar to Mid2p G1 317 521 YNL300W YNL300W YNL300W YPD SGD MIPS 4.49 8.53 6.19 6.19 1.84 3.57 2.56 0.39 undocumented New has 28% similarity to Mid2p over 71 amino acids 5.342 -1.541 5 w433 cgtCACGAAAaag w347 tgaCACGAAAtgt w403 tgaCGCGAAAatg w 404 gtgACGCGaaaat c 440 gtgACGCGcggtt 2 w433 cgtCACGAAAaag w347 tgaCACGAAAtgt 1 w403 tgaCGCGAAAatg 2 w 404 gtgACGCGaaaat c 440 gtgACGCGcggtt 1 c 633 CAAACCAGCGCG 1 c 633 CAAACCAGCGCG unknown similar to Ypt1p and many other ras-like G1 172 402 YNL304W YPT11 YNL304W YPD SGD MIPS 1.28 1.22 1.25 1.25 1.44 1.27 1.35 0.74 undocumented New Protein with similarity to Ypt1p and many other ras-like GTP-binding proteins 1.681 -0.836 2 w473 gatCACGAAAatt w 332 gttACGCGccgcg 1 w473 gatCACGAAAatt 1 w 332 gttACGCGccgcg 1 w 79 TTCGCCAGCGAG unknown binds Sin3p G1 201 546 YNL309W STB1 STB1 YPD SGD MIPS 1.20 1.75 1.45 1.45 2.69 1.09 1.71 0.59 viable New Sin3p-binding protein 2.981 -1.043 1 w 196 cgtACGCGaggcg 1 w 196 cgtACGCGaggcg DNA repair replication factor A 36 kD subunit G1 221 513 YNL312W RFA2 RFA2 YPD SGD MIPS 1.64 1.79 1.71 1.71 2.72 1.56 2.06 0.48 lethal Known DNA replication Factor A; promoter has Mlu1 cell cycle box (MCB) elements 2.484 -1.139 2 w161 gtgACGCGTtaa w124 ttgACGCGTttc 2 w161 gtgACGCGTtaa w124 ttgACGCGTttc 1 w 446 GATACCAGCAAA unknown similar to Akr1p and Ydr126p M/G1 95 346 YNL326C YNL326C YNL326C YPD SGD MIPS 1.90 1.07 1.33 0.75 1.25 1.08 1.16 0.86 viable New Protein with similarity to Akr1p and Ydr126p 1.350 -0.380 w 148 CTAAATCTGGGG cell cycle unknown M/G1 75 268 YNL327W EGT2 EGT2 YPD SGD MIPS 2.07 1.24 1.29 0.77 1.42 1.19 1.30 0.77 viable Known "involved in mother-daughter cell disjunction, most likely through the metabolism of glucans; null mutant has delayed cell separation" 12.610 -0.202 8 c 200 CAAACCAGCATC c 306 GGAGCCAGCGCG c 337 AGAGCCAGCAAG c 388 GGAACCAGCAGA C 200 CAAACCAGCATC C 306 GGAGCCAGCGCG C 337 AGAGCCAGCAAG C 388 GGAACCAGCAGA 1 w 310 cggACGCGctggc 4 C 200 CAAACCAGCATC C 306 GGAGCCAGCGCG C 337 AGAGCCAGCAAG C 388 GGAACCAGCAGA 4 c 200 CAAACCAGCATC c 306 GGAGCCAGCGCG c 337 AGAGCCAGCAAG c 388 GGAACCAGCAGA protein folding mitochondrial chaperonin M/G1 97 345 YNL328C MDJ2 MDJ2 YPD SGD MIPS 1.27 1.43 1.06 1.06 1.44 1.16 1.29 0.77 viable New "Protein of the mitochondrial inner membrane with similarity to E. coli DnaJ and other DnaJ-like proteins, function partially overlaps that of Mdj1p " 2.219 -0.381 8 w 584 CAAACCAGCATC w 478 GGAGCCAGCGCG w 447 AGAGCCAGCAAG w 396 GGAACCAGCAGA w 584 CAAACCAGCATC w 478 GGAGCCAGCGCG w 447 AGAGCCAGCAAG w 396 GGAACCAGCAGA 1 c 475 cggACGCGctggc 4 w 584 CAAACCAGCATC w 478 GGAGCCAGCGCG w 447 AGAGCCAGCAAG w 396 GGAACCAGCAGA 4 w 584 CAAACCAGCATC w 478 GGAGCCAGCGCG w 447 AGAGCCAGCAAG w 396 GGAACCAGCAGA unknown unknown G1 135 594 YNL339C YNL339C YNL339C YPD SGD MIPS 1.20 1.84 1.24 1.24 1.48 1.13 1.14 0.87 undocumented New Protein with similarity to other subtelomerically-encoded proteins 3.448 -0.644 1 w 255 ctgACGCGccata 1 w 255 ctgACGCGccata c 509 TAAAAGCTGGGG unknown unknown S 474 688 YNR009W YNR009W YNR009W YPD SGD MIPS 3.54 1.61 2.39 2.39 1.71 1.22 1.44 0.69 undocumented New novel 4.744 -2.897 2 w 242 tcgACGCGccttt c 251 tcgACGCGACGCG 2 w 242 tcgACGCGccttt c 251 tcgACGCGACGCG 1 w 493 AACACCAGCCAG mating a-agglutinin anchor subunit M/G1 96 307 YNR044W AGA1 AGA1 YPD SGD MIPS 1.26 1.23 1.25 0.80 2.26 1.17 1.39 0.72 undocumented Known a-Agglutinin anchor subunit 3.251 -0.381 1 c 289 cgtACGCGattcg 1 c 289 cgtACGCGattcg 2 c 267 GATGCCAGCCAC c 470 GGAACCAGCCGG lysine biosynthesis saccharopine dehydrogenase G2/M 695 104 YNR050C LYS9 LYS9 YPD SGD MIPS 1.48 1.20 1.33 0.75 1.44 1.03 1.18 0.85 viable New "Saccharopine dehydrogenase (NADP+, L-glutamate forming) (saccharopine reductase), seventh step in lysine biosynthesis pathway " 1.480 1.651 1 c 596 ATTGCCAGCTTT unknown similar to Pep1p S 435 354 YNR066C YNR066C YNR066C YPD SGD MIPS 1.08 1.17 1.04 1.04 3.52 2.56 3.00 0.33 undocumented New Protein with similarity to Pep1p 1.508 -2.506 unknown unknown M/G1 62 267 YNR067C YNR067C YNR067C YPD SGD MIPS 1.75 1.37 1.13 0.89 2.50 1.31 1.81 0.55 undocumented New "similar to AFC2/YLR144c, which is involved in polarized cortical actin assembly" 8.576 -0.100 3 w 286 AAAGCCAGCAGA w 286 AAAGCCAGCAGA C 402 TATGCCAGCAAA 1 w 272 aggCACGAAAtct 2 w 286 AAAGCCAGCAGA C 402 TATGCCAGCAAA 1 w 286 AAAGCCAGCAGA cell wall biogenesis chitin synthase 3 subunit G1 309 535 YOL007C CSI2 CSI2 YPD SGD MIPS 7.34 2.92 4.63 4.63 10.40 4.76 7.04 0.14 viable New may be a structural component of the chitin synthase 3 complex 10.520 -1.507 5 w330 ttaCACGAAAagt w269 agcCACGAAAtgc w365 gatCGCGAAAaaa c398 aaaCGCGAAAacc c 397 aaaACGCGaaaac 2 w330 ttaCACGAAAagt w269 agcCACGAAAtgc 2 w365 gatCGCGAAAaaa c398 aaaCGCGAAAacc 1 c 397 aaaACGCGaaaac unknown similar to phospholipases M/G1 66 602 YOL011W YOL011W YOL011W YPD SGD MIPS 2.31 2.89 2.58 2.58 2.16 1.20 1.61 0.62 undocumented New Protein with similarity to phospholipases 1.673 -0.130 1 w 494 TACGCCAGCATC 1 w 323 ctcCACGAAAata 3 c 469 attACGCGggcag c 507 ttaACGCGagatg c 595 gtgACGCGgtatc 1 w 494 TACGCCAGCATC chromatin structure histone-related S 476 696 YOL012C HTA3 HTA3 YPD SGD MIPS 1.01 2.18 1.47 1.47 1.61 1.39 1.50 0.67 viable New Histone-related protein that can suppress histone H4 point mutation 1.891 -2.909 1 w 195 gtgCACGAAAaca 1 w 195 gtgCACGAAAaca 2 w 460 TCTGCCAGCCGC c 230 AACACCAGCGGC unknown unknown G2/M 620 177 YOL014W YOL014W YOL014W YPD SGD MIPS 1.66 1.13 1.21 0.83 1.33 1.33 1.33 0.75 viable New Protein of unknown function 1.511 2.169 signaling calmodulin-dependent protein kinase G1 383 353 YOL016C CMK2 CMK2 YPD SGD MIPS 1.30 1.28 1.29 1.29 1.59 1.09 1.32 0.76 viable New Calcium/calmodulin-dependent serine/threonine protein kinase (CaM kinase) type II 1.468 -1.985 unknown unknown G1 269 526 YOL017W YOL017W YOL017W YPD SGD MIPS 1.34 2.48 1.82 1.82 3.02 1.30 1.98 0.51 undocumented New similarity to YFR013W 5.782 -1.333 2 w187 taaACGCGTgaa w174 tttACGCGTtta 2 w187 taaACGCGTgaa w174 tttACGCGTtta unknown unknown G1 311 755 YOL019W YOL019W YOL019W YPD SGD MIPS 4.23 3.27 3.72 3.72 3.05 2.63 2.83 0.35 undocumented New similarity to Rim9p and YFR012w 4.819 -1.508 1 c 403 cccACGCGACGCG 1 c 403 cccACGCGACGCG 2 c 350 GGAGCCAGCCGT c 598 AAGACCAGCGAT 1 c 598 AAGACCAGCGAT c 147 TGAATGCTGGGG unknown similar to Gas1p S/G2 586 148 YOL030W YOL030W YOL030W YPD SGD MIPS 1.88 1.11 1.30 1.30 1.47 1.23 1.35 0.74 viable New strong similarity to Gas1 3.371 2.475 1 w 323 gtaACGCGcttta 1 w 323 gtaACGCGcttta unknown unknown G1 241 551 YOL034W YOL034W YOL034W YPD SGD MIPS 1.14 1.56 1.33 1.33 2.07 1.11 1.51 0.66 viable New similarity to S.pombe rad18 and rpgL29 genes and other members of the SMC superfamily 1.691 -1.238 3 c400 aatCACGAAAaat c138 caaCGCGAAAgtt c 137 ccaACGCGaaagt 1 c400 aatCACGAAAaat 1 c138 caaCGCGAAAgtt 1 c 137 ccaACGCGaaagt 1 c 206 TATGCCAGCTTG arginine biosynthesis arginosuccinate synthetase S/G2 488 370 YOL058W ARG1 ARG1 YPD SGD MIPS 1.58 1.85 1.71 0.59 1.36 1.44 1.03 1.03 undocumented New Argininosuccinate synthetase (citrulline--aspartate ligase) 1.574 -3.011 cytoskeleton spindle pole body component G2/M 616 174 YOL069W NUF2 NUF2 YPD SGD MIPS 1.02 1.30 1.13 0.89 1.68 1.27 1.15 0.87 lethal New "Coiled-coil protein of the spindle pole body, required for nuclear division " 2.448 2.240 2 w 426 GTCACCAGCAGG w 142 GGTGCCAGCCAT unknown unknown G2/M 739 89 YOL070C YOL070C YOL070C YPD SGD MIPS 1.37 1.30 1.03 1.03 2.05 3.57 2.70 2.70 undocumented New "shows some homology to HPC2, which is involved in histone transcription" 2.886 1.337 1 c 86 GGTGCCAGCCAT unknown putative protein disulfide isomerase S/G2 499 371 YOL088C MPD2 MPD2 YPD SGD MIPS 1.25 1.25 1.00 1.00 2.00 1.16 1.31 0.76 viable New Protein disulfide isomerase-related protein 1.471 -3.101 DNA repair MutS homolog; mismatch repair G1 312 528 YOL090W MSH2 MSH2 YPD SGD MIPS 3.11 2.50 2.79 2.79 4.01 1.35 2.33 0.43 viable Known "Component with Msh3p and Msh6p of DNA mismatch binding factor, involved in repair of single base mismatches and short insertions/deletions" 8.095 -1.509 3 w168 gtcACGCGTaaa w138 aagACGCGTgaa c 299 ggtACGCGcatag 2 w168 gtcACGCGTaaa w138 aagACGCGTgaa 1 c 299 ggtACGCGcatag 1 w 36 GAAACCAGCAAG 1 w 36 GAAACCAGCAAG DNA replication "replication factor C, 37 kDa subunit" G1 132 374 YOL094C RFC4 RFC4 YPD SGD MIPS 1.30 1.20 1.04 1.04 1.48 1.02 1.23 0.81 lethal New "Replication factor C, 37 kDa subunit " 1.357 -0.620 1 w139 taaACGCGTttt 1 w139 taaACGCGTttt unknown unknown M/G1 21 261 YOL101C YOL101C YOL101C YPD SGD MIPS 1.84 1.27 1.21 1.21 1.11 1.14 1.12 0.89 undocumented New Protein of unknown function 1.937 0.307 1 w 446 AGTACCAGCTGT 1 w 446 AGTACCAGCTGT unknown suppresses bud emergence defect S/G2 495 742 YOL112W MSB4 MSB4 YPD SGD MIPS 1.25 1.27 1.26 1.26 1.26 1.22 1.02 0.98 undocumented New Multicopy suppressor of bud emergence mutants 1.326 -3.051 1 c 270 ataACGCGaagca 1 c 270 ataACGCGaagca unknown similar to human DS-1 protein S/G2 556 165 YOL114C YOL114C YOL114C YPD SGD MIPS 1.85 1.05 1.33 0.75 1.80 1.08 1.29 0.77 undocumented New Protein with similarity to human DS-1 protein 1.505 2.803 1 c 123 agaCACGAAAtgt 1 c 123 agaCACGAAAtgt unknown similar to mammalian monocarboxylate G2/M 732 112 YOL119C YOL119C YOL119C YPD SGD MIPS 1.72 2.13 1.91 0.52 1.02 1.16 1.09 0.92 undocumented New Protein with weak similarity to mammalian monocarboxylate transporter proteins 1.711 1.396 1 w 475 ccgCACGAAAaca unknown similar to glycophospholipid-anchored surface glycoprotein GAS1 G2/M 682 262 YOL132W YOL132W YOL132W YPD SGD MIPS 2.22 1.27 1.68 0.60 1.98 1.12 1.33 0.75 viable New Protein with similarity to glycophospholipid-anchored surface glycoprotein GAS1 1.359 1.752 unknown unknown G2/M 724 15 YOL150C YOL150C YOL150C YPD SGD MIPS 1.22 1.20 1.01 1.01 2.04 1.34 1.65 0.60 undocumented New Protein of unknown function 1.416 1.445 1 c 63 aaaACGCGaagca unknown major facilitator superfamily G2/M 697 192 YOL158C YOL158C YOL158C YPD SGD MIPS 1.54 1.75 1.64 0.61 1.21 1.18 1.01 0.99 undocumented New members of family 2 of the multidrug permeases all have 14 predicted membrane-spanning regions 3.267 1.641 1 w 628 agtCACGAAAtga 1 w 659 TCCGCCAGCAAA drug resistance unknown M/G1 82 22 YOR018W ROD1 ROD1 YPD SGD MIPS 1.09 1.02 1.03 0.97 1.91 1.08 1.43 0.70 viable New Protein that mediates resistance to o-dinitrobenzene (O-DNB) 2.336 -0.253 1 w 49 tcaACGCGatttc unknown unknown G2/M 719 40 YOR023C YOR023C YOR023C YPD SGD MIPS 1.64 1.06 1.24 1.24 1.14 1.16 1.01 0.99 undocumented New Protein of unknown function 1.322 1.524 1 w 643 gttACGCGccgga silencing unknown G2/M 652 231 YOR025W HST3 HST3 YPD SGD MIPS 1.31 1.11 1.09 0.92 2.31 3.39 2.80 2.80 viable New has 54% identity to Sir2p over 37 amino acids; null mutant has silencing defect 8.396 1.961 1 c 546 AGCACCAGCATC DNA repair exonuclease; also recombination G1 165 453 YOR033C EXO1 DHS1 YPD SGD MIPS 2.49 1.18 1.72 1.72 1.51 1.23 1.36 0.73 viable New Mismatch repair and recombination exonuclease that interacts with Msh2p 2.848 -0.806 2 w257 cttACGCGTctt c 314 aaaACGCGaactt 1 w257 cttACGCGTctt 1 c 314 aaaACGCGaactt unknown unknown G2/M 736 160 YOR049C YOR049C YOR049C YPD SGD MIPS 1.18 1.04 1.06 0.94 1.34 1.01 1.15 0.87 undocumented New Protein of unknown function 1.486 1.363 1 c 155 ACAACCAGCAGT 1 c 155 ACAACCAGCAGT unknown unknown M/G1 40 31 YOR052C YOR052C YOR052C YPD SGD MIPS 1.05 1.49 1.25 0.80 1.69 1.14 1.22 0.82 undocumented New Protein of unknown function 1.711 0.103 1 w 368 CTTGCCAGCTTA 1 w 368 CTTGCCAGCTTA mitosis spindle midzone component G2/M 687 187 YOR058C ASE1 ASE1 YPD SGD MIPS 1.07 1.37 1.13 0.88 1.55 1.96 1.13 1.13 viable Known "Microtubule-associated protein localized to the spindle midzone, required for anaphase spindle elongation " 4.248 1.701 1 w 250 CCCAATGAGGTAAAAGGTAAATAA 1 w 250 CCCAATGAGGTAAAAGGTAAATAA 1 w 614 AAAACCAGCTAA unknown unknown M/G1 2 73 YOR066W YOR066W YOR066W YPD SGD MIPS 2.18 2.27 2.23 0.45 1.11 1.77 1.40 1.40 undocumented New similar to YKR077W 6.828 0.546 4 w 262 ACAGCCAGCAAA w 262 ACAGCCAGCAAA C 125 GCAACCAGCTCT w 378 TTTCCCTAATAGGAAA 2 w 421 gtaACGCGctagt c 429 gttACGCGgcgac 2 w 262 ACAGCCAGCAAA C 125 GCAACCAGCTCT 1 w 262 ACAGCCAGCAAA unknown unknown S 464 735 YOR073W YOR073W YOR073W YPD SGD MIPS 1.86 1.08 1.42 1.42 1.60 1.04 1.29 0.78 undocumented New novel 2.881 -2.795 DNA replication thymidylate synthase G1 243 504 YOR074C CDC21 CDC21 YPD SGD MIPS 2.55 3.24 2.88 2.88 3.63 1.08 1.98 0.51 undocumented Known "Thymidylate synthase, converts dUMP to dTMP" 4.771 -1.243 2 w120 gcgACGCGTtag w 125 aagACGCGACGCG 1 w120 gcgACGCGTtag 1 w 125 aagACGCGACGCG 1 w 684 TCCGCCAGCTTC secretion ER membrane t-SNARE G1 281 390 YOR075W UFE1 UFE1 YPD SGD MIPS 1.12 1.27 1.19 1.19 1.65 1.14 1.37 0.73 lethal New Syntaxin homolog (t-SNARE) of the endoplasmic reticulum required for targeting of vesicles to the ER 1.457 -1.376 2 w510 gaaACGCGTcaa w473 ttaACGCGTcac 2 w510 gaaACGCGTcaa w473 ttaACGCGTcac 1 c 188 GATACCAGCAAA unknown unknown G1 369 632 YOR083W YOR083W YOR083W YPD SGD MIPS 1.41 1.53 1.04 1.04 1.28 1.05 1.11 0.90 undocumented New has 48% identity to Ykr091p over 31 amino acids 1.436 -1.845 unknown unknown G1 389 799 YOR084W YOR084W YOR084W YPD SGD MIPS 1.21 11.42 3.07 3.07 1.54 1.18 1.35 0.74 undocumented New Protein of unknown function 2.825 -2.084 unknown unknown G2/M 680 173 YOR104W YOR104W YOR104W YPD SGD MIPS 1.41 1.18 1.29 0.78 1.53 1.29 1.09 0.92 undocumented New novel 1.360 1.762 1 w 514 tatACGCGTgtt 2 c 481 TTTACCAGCCAT c 524 TACGCCAGCCAA unknown unknown G2/M 612 169 YOR105W YOR105W YOR105W YPD SGD MIPS 1.20 1.21 1.00 1.00 1.05 1.19 1.12 0.89 undocumented New Protein of unknown function 1.590 2.280 unknown unknown G1 356 458 YOR114W YOR114W YOR114W YPD SGD MIPS 1.43 1.79 1.60 1.60 3.27 1.39 2.13 0.47 undocumented New novel 4.105 -1.733 3 c294 aagCACGAAAcgc c301 aaaCGCGAAAaaa c 300 gaaACGCGaaaaa 1 c294 aagCACGAAAcgc 1 c301 aaaCGCGAAAaaa 1 c 300 gaaACGCGaaaaa unknown unknown G1 285 376 YOR115C YOR115C YOR115C YPD SGD MIPS 1.42 1.05 1.16 1.16 1.06 1.02 1.04 0.96 undocumented New Protein of unknown function 1.321 -1.392 1 c 134 ttgACGCGagttt 1 c 134 ttgACGCGagttt 1 w 156 AGAACCAGCGTA 1 w 156 AGAACCAGCGTA unknown isoamyl acetate hydrolytic enzyme M/G1 70 19 YOR126C IAH2 IAH1 YPD SGD MIPS 1.83 1.35 1.57 0.64 1.30 1.12 1.08 0.93 viable New Isoamyl acetate-hydrolyzing esterase enzyme 1.702 -0.161 bud site selection putative GTPase-activating protein (GAP) for GAP for Cdc42p or Rho1p M/G1 28 21 YOR127W RGA1 RGA1 YPD SGD MIPS 1.47 1.16 1.13 0.89 1.80 1.32 1.54 0.65 viable New Rho-type GTPase-activating protein (GAP) for Cdc42p 1.481 0.250 unknown unknown G2/M 618 674 YOR129C YOR129C YOR129C YPD SGD MIPS 1.34 1.45 1.04 1.04 1.32 1.25 1.29 0.78 undocumented New novel 1.409 2.190 1 w 425 AGTACCAGCAAA unknown unknown G1 166 452 YOR144C YOR144C YOR144C YPD SGD MIPS 2.66 1.07 1.69 1.69 1.88 1.09 1.43 0.70 undocumented New weak similarity to human DNA-binding protein PO-GA and to bacterial H+-transporting ATP synthases 1.830 -0.810 1 w150 caaACGCGTaac 1 w150 caaACGCGTaac unknown unknown S/G2 588 133 YOR152C YOR152C YOR152C YPD SGD MIPS 1.15 1.32 1.07 0.94 1.75 1.23 1.47 0.68 undocumented New Protein of unknown function 1.425 2.458 drug resistance transporter G2/M 611 150 YOR153W PDR5 PDR5 YPD SGD MIPS 1.63 1.15 1.37 1.37 1.23 1.72 1.46 0.69 viable New "Multidrug resistance protein of the ATP-binding cassette (ABC) superfamily, probable drug-efflux pump " 5.116 2.282 heme biosynthesis ferrochelatase (protoheme ferrolyase) G1 354 395 YOR176W HEM15 HEM15 YPD SGD MIPS 2.77 1.00 1.66 1.66 2.17 1.05 1.51 0.66 viable New "Ferrochelatase (protoheme ferrolyase), last step in heme biosynthesis pathway, catalyzes insertion of ferrous iron into protoporphyrin IX " 2.696 -1.711 2 w 566 tcgACGCGcaatg w 167 aggACGCGaagga 2 w 566 tcgACGCGcaatg w 167 aggACGCGaagga 2 c 296 ATTGCCAGCGGA c 395 ATGGCCAGCATC 1 c 395 ATGGCCAGCATC w 501 GTTTATCTGGGG polarized growth unknown S 483 746 YOR188W MSB1 MSB1 YPD SGD MIPS 1.75 1.72 1.73 1.73 2.16 1.15 1.37 0.73 viable New Protein that may play a role in polarity establishment and bud formation 3.043 -2.980 mitosis unknown; synthetic lethal with kar3 G1 376 435 YOR195W SLK19 SLK19 YPD SGD MIPS 2.21 1.66 1.91 1.91 2.80 1.47 2.03 0.49 viable New Protein involved with Kar3p in control of spindle dynamics 2.660 -1.921 2 w 462 tccCGCGAAAaca c 425 ataACGCGaagaa 1 w 462 tccCGCGAAAaca 1 c 425 ataACGCGaagaa transcription "shared subunit of RNA polymerases I, II, and III" G2/M 770 79 YOR229W WTM2 WTM2 YPD SGD MIPS 3.06 2.00 2.47 0.40 1.23 1.76 1.20 1.20 viable New Transcriptional modulator protein involved in meiotic regulation and silencing (GB:AF001451) 5.155 0.963 meiosis transcription factor M/G1 88 326 YOR230W WTM1 WTM1 YPD SGD MIPS 1.42 1.39 1.40 0.71 1.09 2.34 1.60 1.60 viable New Transcriptional modulator involved in meiotic regulation and silencing (GB:AF001451) 1.835 -0.316 2 c 496 GAAGCCAGCACA C 496 GAAGCCAGCACA 1 w 477 ggaACGCGccggg 1 C 496 GAAGCCAGCACA 1 c 496 GAAGCCAGCACA RNA processing U3 snRNA S/G2 562 615 YOR235W YOR235W SNR17A YPD SGD MIPS 1.68 1.40 1.10 0.91 1.22 1.11 1.17 0.86 undocumented New questionable ORF 1.636 2.728 1 w 256 GAGGCCAGCACA 1 w 256 GAGGCCAGCACA sporulation unknown; similar to class II family of aminoacyl-tRNA synthetases M/G1 51 263 YOR242C YOR242C SSP2 YPD SGD MIPS 1.28 1.01 1.13 1.13 1.34 1.17 1.07 0.93 undocumented New Protein with similarity to class II family of aminoacyl-tRNA synthetases 6.810 0.004 1 C 671 AGAGCCAGCCAA 1 c 74 aatACGCGagaat 1 C 671 AGAGCCAGCCAA unknown unknown; similar to Svs1p; suppressor of Rad53 lethality G1 357 766 YOR247W YOR247W SRL1 YPD SGD MIPS 4.89 5.02 4.95 4.95 3.80 2.56 3.12 0.32 undocumented New similar to SVS1 2.970 -1.733 4 w543 caaCACGAAAcgc w589 agaCGCGAAAgac w 590 aagACGCGaaaga c 190 aatACGCGagaaa 1 w543 caaCACGAAAcgc 1 w589 agaCGCGAAAgac 2 w 590 aagACGCGaaaga c 190 aatACGCGagaaa 1 w 563 CCTTTTTCGGAATATGTCAACAA unknown unknown G1 353 770 YOR248W YOR248W YOR248W YPD SGD MIPS 4.88 5.10 4.99 4.99 4.27 2.00 2.92 0.34 undocumented New novel; questionable ORF 2.855 -1.701 1 c 527 aatACGCGagaaa 1 c 527 aatACGCGagaaa 1 c 150 TGAACCAGCTCG mRNA 3'-end processing cleavage/polyadenylation factor CF IA component S 419 362 YOR250C CLP1 CLP1 YPD SGD MIPS 1.33 1.23 1.28 0.78 2.19 1.32 1.29 0.78 undocumented New "Subunit of cleavage and polyadenylation factor IA,required for 3'-end processing of pre-mRNA " 1.664 -2.413 1 c 90 TTTGCCAGCAGT unknown similar to secretory protein Ssp134p G2/M 683 124 YOR256C YOR256C YOR256C YPD SGD MIPS 1.00 1.11 1.05 0.95 2.16 1.31 1.28 0.78 undocumented New Protein with similarity to secretory protein Ssp134p 4.576 1.732 unknown unknown G2/M 655 50 YOR258W YOR258W YOR258W YPD SGD MIPS 1.52 1.14 1.32 0.76 1.79 1.32 1.17 0.86 undocumented New Protein of unknown function 1.754 1.940 unknown similar to adenosine A1 receptors M/G1 37 270 YOR263C YOR263C YOR263C YPD SGD MIPS 1.59 1.50 1.03 0.97 1.29 1.27 1.28 0.78 undocumented New novel; questionable ORF 3.690 0.139 unknown unknown M/G1 25 272 YOR264W YOR264W YOR264W YPD SGD MIPS 1.21 1.10 1.15 0.87 1.58 1.02 1.27 0.79 undocumented New novel 3.269 0.292 7 w 344 AAAGCCAGCGCT w 266 ATAACCAGCAAA c 417 TCGGCCAGCAAT w 344 AAAGCCAGCGCT w 318 TTGACCAGCCTT w 266 ATAACCAGCAAA C 417 TCGGCCAGCAAT 4 w 344 AAAGCCAGCGCT w 318 TTGACCAGCCTT w 266 ATAACCAGCAAA C 417 TCGGCCAGCAAT 3 w 344 AAAGCCAGCGCT w 266 ATAACCAGCAAA c 417 TCGGCCAGCAAT vacuolar acidification vacuolar H+-ATPase 95 kD subunit G1 114 255 YOR270C VPH1 VPH1 YPD SGD MIPS 1.52 1.00 1.23 1.23 1.80 1.19 1.23 0.81 viable New "Vacuolar H-ATPase (V-ATPase) 94 kDa subunit of membrane (V0) sector, essential for vacuolar acidification and vacuolar H-ATPase (V-ATPase) activity " 1.336 -0.526 unknown similar to members of major facilitator superfamily G2/M 726 163 YOR273C YOR273C YOR273C YPD SGD MIPS 1.42 1.04 1.17 0.86 1.23 1.12 1.17 0.85 undocumented New Protein with similarity to members of major facilitator superfamily (MFS) multidrug-resistance (MFS-MDR) protein family 2.891 1.428 unknown similar to phosphoglycerate mutases G1 365 375 YOR283W YOR283W YOR283W YPD SGD MIPS 1.05 1.30 1.17 0.86 1.15 1.02 1.06 0.94 undocumented New Protein with similarity to phosphoglycerate mutases 1.414 -1.816 unknown meiosis (putative) G2/M 626 49 YOR298W YOR298W YOR298W YPD SGD MIPS 1.95 1.21 1.27 0.79 2.24 1.06 1.45 0.69 undocumented New Protein of unknown function 2.957 2.130 secretion unknown; suppresses ypt1 null G1 143 298 YOR307C SLY41 SLY41 YPD SGD MIPS 1.67 1.20 1.42 1.42 1.20 1.09 1.14 0.88 viable New Protein involved in secretory pathway 4.219 -0.687 unknown unknown G1 126 297 YOR308C YOR308C YOR308C YPD SGD MIPS 1.16 1.09 1.03 1.03 1.87 1.19 1.26 0.80 undocumented New Protein of unknown function 4.945 -0.585 1 c 407 ggaACGCGagggg 1 c 407 ggaACGCGagggg sporulation putative cell wall component G2/M 721 182 YOR313C SPS4 SPS4 YPD SGD MIPS 1.55 1.35 1.07 0.93 1.04 1.22 1.08 0.92 viable New "Protein expressed in mid-late (8-14 hr) sporulation, possible cell wall component " 1.976 1.464 1 w 226 cagACGCGTtgc 1 w 201 ttgACGCGcgcca unknown unknown G2/M 718 183 YOR314W YOR314W YOR314W YPD SGD MIPS 1.84 1.02 1.37 0.73 1.49 1.27 1.09 0.92 undocumented New novel 2.546 1.547 1 w 569 acaACGCGctcta unknown unknown G2/M 633 184 YOR315W YOR315W YOR315W YPD SGD MIPS 1.19 1.03 1.07 0.93 3.06 1.47 2.12 2.12 undocumented New novel 3.634 2.095 1 c 93 taaACGCGcctaa c 137 TCTATCCTGGGG fatty acid metabolism long chain fatty acyl:CoA synthetase M/G1 78 344 YOR317W FAA1 FAA1 YPD SGD MIPS 2.03 1.69 1.85 1.85 1.51 1.10 1.29 0.78 viable New "Long-chain fatty acid CoA ligase (fatty acid activator 1), can incorporate exogenous myristate into myristoyl-CoA and other fatty acids to the CoA derivatives" 1.467 -0.233 1 w 628 TTTGCCAGCTGC 1 c 238 atcCGCGAAAgga 1 c 275 aaaACGCGcgaga 1 w 628 TTTGCCAGCTGC unknown unknown G1 292 636 YOR320C YOR320C YOR320C YPD SGD MIPS 2.77 1.05 1.70 1.70 1.55 1.05 1.28 0.78 undocumented New Protein of unknown function 3.850 -1.425 1 w 195 agcACGCGaccgt 1 w 195 agcACGCGaccgt 1 c 108 TCCACCAGCCTG protein glycosylation dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase G1 256 771 YOR321W PMT3 PMT3 YPD SGD MIPS 3.26 2.43 2.81 2.81 1.40 1.39 1.39 0.72 viable New "Mannosyltransferase (dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase), involved inititation of O-glycosylation" 1.702 -1.277 1 w 148 gcgACGCGaggaa 1 w 148 gcgACGCGaggaa proline biosynthesis gamma-glutamyl phosphate reductase S/G2 534 708 YOR323C PRO2 PRO2 YPD SGD MIPS 1.11 1.06 1.09 1.09 1.48 1.00 1.22 0.82 lethal New "Gamma-glutamyl phosphate reductase (phosphoglutamate dehydrogenase), proline biosynthetic enzyme " 2.082 3.030 3 w 444 caaCACGAAAtcc w 296 ggtACGCGTaca w 211 tcaACGCGcatgg 1 w 444 caaCACGAAAtcc 1 w 296 ggtACGCGTaca 1 w 211 tcaACGCGcatgg unknown unknown S/G2 527 707 YOR324C YOR324C YOR324C YPD SGD MIPS 1.28 1.03 1.15 0.87 2.28 1.12 1.60 0.63 undocumented New Protein of unknown function 3.430 3.062 vacuolar acidification vacuolar H+-ATPase V1 domain 27 KD subunit S/G2 558 372 YOR332W VMA4 VMA4 YPD SGD MIPS 1.12 1.18 1.15 0.87 1.87 1.33 1.19 0.84 viable New "Vacuolar H-ATPase (V-ATPase) hydrophilic subunit (subunit E), 27 kDa subunit of V1 sector " 1.429 2.766 transcription Ty1 enhancer activator S/G2 572 35 YOR337W TEA1 TEA1 YPD SGD MIPS 1.04 2.48 1.60 1.60 1.22 1.49 1.35 0.74 viable New Ty1 enhancer activator of the Gal4p-type family of DNA-binding proteins 1.547 2.569 1 w 454 attACGCGacggt 1 w 454 attACGCGacggt unknown unknown M/G1 46 379 YOR342C YOR342C YOR342C YPD SGD MIPS 1.50 1.15 1.31 1.31 2.17 1.00 1.47 0.68 undocumented New Protein of unknown function 1.503 0.041 4 w 697 GGAGCCAGCACT c 307 AAGACCAGCATT w 697 GGAGCCAGCACT C 307 AAGACCAGCATT 2 c 492 aaaCGCGAAAagc c 592 aggCGCGAAAtac 2 w 460 taaACGCGcatct c 491 aaaACGCGaaaag 2 w 697 GGAGCCAGCACT C 307 AAGACCAGCATT 2 w 697 GGAGCCAGCACT c 307 AAGACCAGCATT respiration (putative) unknown; suppresses nam9-1 G1 218 378 YOR355W GDS1 GDS1 YPD SGD MIPS 1.46 1.98 1.16 1.16 1.27 1.03 1.14 0.87 viable New "Protein that suppresses nam9-1 glycerol deficient phenotype when overexpressed, involved in nuclear control of mitochondria " 1.629 -1.124 unknown unknown G1 413 724 YOR372C YOR372C YOR372C YPD SGD MIPS 1.85 1.10 1.43 1.43 1.19 1.24 1.02 1.02 undocumented New novel 1.371 -2.363 3 c436 cacCACGAAAgct w179 cctCGCGAAAaga c 454 cgaACGCGcacag 1 c436 cacCACGAAAgct 1 w179 cctCGCGAAAaga 1 c 454 cgaACGCGcacag 1 c 405 CGAGCCAGCTGG unknown unknown G2/M 720 251 YOR383C YOR383C YOR383C YPD SGD MIPS 1.28 1.07 1.17 0.85 1.62 1.08 1.22 0.82 undocumented New Protein of unknown function 2.223 1.475 1 c 576 AAAACCAGCATC 1 c 576 AAAACCAGCATC unknown unknown S/G2 485 34 YOR391C YOR391C YOR391C YPD SGD MIPS 1.18 1.91 1.27 1.27 1.03 1.05 1.04 0.96 undocumented New Protein of unknown function 2.426 -3.000 unknown unknown M/G1 71 382 YPL014W YPL014W YPL014W YPD SGD MIPS 2.29 1.52 1.23 1.23 1.06 1.38 1.14 1.14 undocumented New Protein of unknown function 1.591 -0.161 1 w 289 tttACGCGTcac unknown unknown S/G2 598 51 YPL021W SRD2 ECM23 YPD SGD MIPS 1.28 1.04 1.11 0.90 1.71 2.46 1.20 1.20 undocumented New Protein with similarity to Srd1p 2.258 2.393 unknown unknown S/G2 566 38 YPL025C YPL025C YPL025C YPD SGD MIPS 1.76 1.89 1.82 0.55 1.47 1.41 1.02 0.98 undocumented New Protein of unknown function 1.653 2.663 3 w 618 AGTACCAGCCAA c 16 AGAGCCAGCAGA c 545 ACCACCAGCGTA 1 c 16 AGAGCCAGCAGA unknown unknown; styryl dye vacuolar localization G1 408 761 YPL032C SVL3 SVL3 YPD SGD MIPS 2.47 1.06 1.52 1.52 3.25 1.21 1.64 0.61 undocumented New Protein involved in vacuolar uptake of endocytosed vital dyes 2.123 -2.313 H+ homeostasis plasma membrane H+-ATPase G2/M 716 199 YPL036W PMA2 PMA2 YPD SGD MIPS 1.85 1.18 1.48 0.68 1.90 1.55 1.72 1.72 viable New H+-transporting P-type ATPase of the plasma membrane; almost identical to PMA1 3.777 1.553 unknown unknown S 421 361 YPL054W LEE1 LEE1 YPD SGD MIPS 1.33 1.40 1.37 1.37 2.74 1.27 1.87 0.54 undocumented New Protein of unknown function 1.734 -2.413 1 c 348 aagCACGAAAata 1 c 348 aagCACGAAAata sphingolipid metabolism suppresses cls2-2and rvs161 G1 204 556 YPL057C SUR1 SUR1 YPD SGD MIPS 1.92 2.13 2.02 2.02 1.91 1.61 1.76 0.57 undocumented New Protein required for the synthesis of mannosylated sphingolipids 3.412 -1.065 2 w630 tccCACGAAAtcc c 534 gcgACGCGACGCG 1 w630 tccCACGAAAtcc 1 c 534 gcgACGCGACGCG drug resistance transporter G2/M 696 179 YPL058C PDR12 PDR12 YPD SGD MIPS 2.11 1.29 1.28 0.78 1.57 1.18 1.15 0.87 undocumented New "Protein with similarity to Pdr5p and Snq2p, member of the ATP-binding cassette (ABC) superfamily " 2.589 1.641 ethanol utilization acetaldehyde dehydrogenase G2/M 757 120 YPL061W ALD6 ALD6 YPD SGD MIPS 2.58 2.09 2.32 0.43 1.71 1.28 1.48 1.48 undocumented New Cytosolic acetaldehyde dehydrogenase 6.189 1.098 2 w 648 GCAACCAGCACG w 554 ATGGCCAGCACC 2 w 648 GCAACCAGCACG w 554 ATGGCCAGCACC glycolysis transcriptional activator S/G2 571 134 YPL075W GCR1 GCR1 YPD SGD MIPS 1.42 1.11 1.13 0.88 1.70 1.04 1.33 0.75 viable New "Protein required for expression of glycolytic genes, causes same spectrum of enzymatic changes as does Gcr2p " 1.946 2.579 1 w 350 ATTACCAGCACA unknown similar to Ybr177p G2/M 743 14 YPL095C YPL095C YPL095C YPD SGD MIPS 1.05 1.19 1.06 1.06 1.06 1.27 1.09 0.91 undocumented New Protein with similarity to Ybr177p 1.692 1.286 arginine metabolism arginase G2/M 644 137 YPL111W CAR1 CAR1 YPD SGD MIPS 1.32 1.11 1.09 1.09 1.02 1.52 1.24 0.81 viable New "Arginase, present in a complex with ornithine carbamyltransferase where it acts as a allosteric regulator " 1.456 1.994 1 w 513 CCTATTCTAGCAACCTTACATGAAACA 1 w 273 cgcCGCGAAAata unknown "similar to Hda1p, Rpd3p, Hos2p, and Hos1p" S/G2 511 681 YPL116W HOS3 HOS3 YPD SGD MIPS 1.50 1.40 1.45 1.45 1.96 1.73 1.07 0.94 undocumented New similarity to Histone deacetylase 3.070 3.129 1 c 110 ccaCACGAAAaga 1 c 110 ccaCACGAAAaga nuclear protein targeting spindle pole body associated protein G1 379 548 YPL124W NIP29 NIP29 YPD SGD MIPS 2.71 2.32 2.51 2.51 2.63 1.05 1.66 0.60 undocumented New Nuclear import protein 2.158 -1.931 2 w116 aaaCGCGAAAagt w 117 caaACGCGaaaag 1 w116 aaaCGCGAAAagt 1 w 117 caaACGCGaaaag chromatin structure histone H1 S 448 788 YPL127C HHO1 HHO1 YPD SGD MIPS 1.13 3.96 2.12 2.12 1.61 1.41 1.51 0.66 viable New Histone H1 8.513 -2.615 2 c 184 cgaCGCGAAAatg c 178 aaaACGCGACGCG 1 c 184 cgaCGCGAAAatg 1 c 178 aaaACGCGACGCG w 635 TATTCGGCGGGG telomere length regulation telomere TTAGGG repeat-binding factor S/G2 550 709 YPL128C TBF1 TBF1 YPD SGD MIPS 1.29 1.59 1.43 1.43 2.37 1.03 1.52 0.66 lethal New Teleomere binding protein that binds to TTAGGG repeats 2.411 2.880 unknown "similar to transcription factors, has Zn[2]-Cys[6]" S/G2 538 621 YPL133C YPL133C YPL133C YPD SGD MIPS 1.20 1.28 1.04 0.97 1.35 1.33 1.01 1.01 undocumented New "Protein with similarity to transcription factors, has Zn[2]-Cys[6] fungal-type binuclear cluster domain in the N-terminal region " 1.354 2.996 unknown similar to Kin4p S/G2 594 216 YPL141C YPL141C YPL141C YPD SGD MIPS 1.10 1.03 1.06 0.94 2.52 1.18 1.46 1.46 undocumented New Serine/threonine protein kinase with similarity to Kin4p 3.542 2.411 c 695 TTTTAAGTGGGG "cell cycle, checkpoint" protein kinase G1 209 523 YPL153C SPK1 RAD53 YPD SGD MIPS 1.01 1.94 1.40 1.40 1.47 1.24 1.35 0.74 lethal Known Serine/threonine/tyrosine protein kinase with a checkpoint function in S and G2 6.135 -1.077 2 w225 tagACGCGTaat w202 gtgACGCGTctc 2 w225 tagACGCGTaat w202 gtgACGCGTctc 1 c 534 CACACCAGCGGT cytoskeleton (putative) kinesin-related protein S/G2 593 217 YPL155C KIP2 KIP2 YPD SGD MIPS 1.02 1.30 1.13 1.13 1.46 1.51 1.48 1.48 viable New functions antagonistically with Kar3p at the spindle poles to influence cytoplasmic microtubule numbers 2.696 2.412 unknown unknown M/G1 36 280 YPL158C YPL158C YPL158C YPD SGD MIPS 1.24 1.07 1.08 0.93 1.52 1.20 1.35 0.74 undocumented New weak similarity to human nucleolin 7.995 0.158 1 C 302 TTCGCCAGCCAT 1 C 302 TTCGCCAGCCAT vanadate resistance unknown G1 249 470 YPL163C SVS1 SVS1 YPD SGD MIPS 11.24 1.14 3.58 3.58 7.19 2.86 4.53 0.22 viable New Suppressor of Vanadate Sensitivity; similar to YOR247 6.967 -1.258 2 c214 aaaCACGAAAtta c232 gaaCACGAAAtgc 2 c214 aaaCACGAAAtta c232 gaaCACGAAAtgc mating alpha factor precursor M/G1 33 310 YPL187W MFALPHA1 MF(ALPHA)1 YPD SGD MIPS 1.41 1.00 1.19 0.84 1.29 1.25 1.02 0.98 viable New Mating pheromone alpha-1 factor 2.416 0.174 unknown unknown G1 340 542 YPL208W YPL208W YPL208W YPD SGD MIPS 3.62 1.70 2.48 2.48 2.13 1.12 1.38 0.73 undocumented New similar to YHL039W 3.444 -1.611 2 c519 ataCACGAAAata w89 aaaACGCGTgaa 1 c519 ataCACGAAAata 1 w89 aaaACGCGTgaa "mitosis, chromosome segregation" protein kinase G1 299 419 YPL209C IPL1 IPL1 YPD SGD MIPS 1.79 1.19 1.23 1.23 1.31 1.23 1.27 0.79 lethal New Serine/threonine protein kinase involved in chromosome segregation 1.864 -1.446 1 w171 ttcACGCGTttt 1 w171 ttcACGCGTttt unknown unknown; bypass of PAM1 G1 187 601 YPL221W YPL221W BOP1 YPD SGD MIPS 1.94 1.51 1.71 1.71 1.83 1.37 1.58 0.63 undocumented New "strong similarity to YGL139W, YAL053W and YOR365C " 1.509 -0.963 2 w612 gaaCACGAAAact c 690 cgaACGCGgtgta 1 w612 gaaCACGAAAact 1 c 690 cgaACGCGgtgta secretion post-Golgi t-SNARE G1 170 296 YPL232W SSO1 SSO1 YPD SGD MIPS 1.62 1.21 1.40 1.40 1.63 1.02 1.26 0.79 viable New Syntaxin homolog (t-SNARE) involved in vesicle transport from Golgi to plasma membrane 1.826 -0.825 1 w 231 gaaACGCGaatac 1 w 231 gaaACGCGaatac 1 w 337 AGAGCCAGCCTT "mitosis, chromosome segregation" unknown G1 347 547 YPL241C CIN2 CIN2 YPD SGD MIPS 1.36 2.04 1.67 1.67 1.29 1.10 1.08 0.92 viable New Protein involved in chromosome segregation 2.854 -1.671 2 w88 ccgACGCGTcta w 65 aaaACGCGaagaa 1 w88 ccgACGCGTcta 1 w 65 aaaACGCGaagaa cytoskeleton IQGAP homolog G2/M 673 218 YPL242C IQG1 IQG1 YPD SGD MIPS 1.10 1.33 1.21 1.21 1.30 1.71 1.49 1.49 lethal New "required for cell division, but not for the progression of the budding or the nuclear cycle" 3.086 1.824 1 w 185 CCTAAAAGAGGAAAGTGTAAACAT 1 c 283 aagCGCGAAAcaa 1 w 185 CCTAAAAGAGGAAAGTGTAAACAT w 554 TAAACCGTGGGG unknown unknown S 458 637 YPL250C YPL250C YPL250C YPD SGD MIPS 1.17 1.63 1.18 1.18 1.65 1.37 1.51 0.66 undocumented New Protein of unknown function 1.561 -2.705 1 w 311 agcACGCGcgcga 1 w 311 agcACGCGcgcga 1 w 482 ATAACCAGCCCA nuclear fusion (putative) Kar3p interactor S 471 692 YPL253C VIK1 VIK1 YPD SGD MIPS 1.34 1.25 1.30 1.30 1.33 1.18 1.25 0.80 undocumented New Probable coiled-coil protein that interacts with Kar3p 2.239 -2.877 1 c 237 tatCGCGAAAcga 1 c 237 tatCGCGAAAcga w 631 TATTCGGCGGGG cell cycle and meiosis unknown G1 254 764 YPL255W BBP1 BBP1 YPD SGD MIPS 2.88 2.52 2.69 2.69 1.56 1.33 1.44 0.69 lethal New Bbp1p-depleted cells arrest with a G2 DNA content and a nonuniform morphology 1.557 -1.273 6 w121 aatCACGAAAaac c539 gtaCACGAAAttc c582 agtCACGAAAcgc c514 catCGCGAAAttt w 154 ctgACGCGacccg c 588 gaaACGCGccaaa 3 w121 aatCACGAAAaac c539 gtaCACGAAAttc c582 agtCACGAAAcgc 1 c514 catCGCGAAAttt 2 w 154 ctgACGCGacccg c 588 gaaACGCGccaaa cell cycle G1/S cyclin G1 294 536 YPL256C CLN2 CLN2 YPD SGD MIPS 8.18 3.94 5.68 5.68 8.25 4.00 5.74 0.17 viable Known G1 cyclin 10.900 -1.429 3 w135 taaCGCGAAAacg w128 aaaACGCGTgaa w 136 ttaACGCGaaaac 1 w135 taaCGCGAAAacg 1 w128 aaaACGCGTgaa 1 w 136 ttaACGCGaaaac 2 w 590 TCAGCCAGCTCA c 226 AGAACCAGCGGC 1 c 226 AGAACCAGCGGC unknown major facilitator superfamily S/G2 533 619 YPL264C YPL264C YPL264C YPD SGD MIPS 1.12 1.05 1.03 0.97 2.59 1.21 1.46 0.68 undocumented New "Protein of unknown function, member of the major facilitator superfamily (MFS) " 1.669 3.036 1 w 51 attCACGAAAgct 1 w 51 attCACGAAAgct transport dicarboxylic amino acid permease G2/M 643 122 YPL265W DIP5 DIP5 YPD SGD MIPS 2.81 1.16 1.81 0.55 1.09 2.51 1.52 1.52 undocumented New Dicarboxylic amino acid permease 1.491 2.005 1 c 567 ACTGCCAGCGAC unknown unknown G1 208 519 YPL267W YPL267W YPL267W YPD SGD MIPS 5.20 3.96 4.54 4.54 3.00 1.45 2.08 0.48 undocumented New weak similarity to C.elegans transcription factor unc-86 4.936 -1.070 3 c146 ctaCGCGAAAtat w129 ttgACGCGTctt c 138 tcaACGCGctacg 1 c146 ctaCGCGAAAtat 1 w129 ttgACGCGTctt 1 c 138 tcaACGCGctacg cytoskeleton cytoplasmic microtubule orientation S 436 620 YPL269W KAR9 KAR9 YPD SGD MIPS 1.10 1.71 1.37 1.37 1.79 1.02 1.32 0.76 viable New "Protein of the cell cortex required for the congression (nuclear migration) step of karyogamy, involved in proper orientation of cytoplasmic microtubules " 2.398 -2.514 1 w 259 aagACGCGgcaaa 1 w 259 aagACGCGgcaaa unknown similar to Gap1p and other amino acid permeases S 459 641 YPL274W YPL274W YPL274W YPD SGD MIPS 1.59 1.57 1.01 1.01 1.49 1.21 1.11 0.90 undocumented New Protein with similarity to Gap1p and other amino acid permeases 2.111 -2.705 1 w 580 TCTGCCAGCTTA w 513 CCTATTCTAGCAACCTTACATGAAACA unknown similar to other subtelomerically-encoded protein M/G1 87 567 YPL283C YPL283C YPL283C YPD SGD MIPS 1.22 1.34 1.05 1.05 1.55 1.12 1.32 0.76 undocumented New Protein with similarity to other subtelomerically-encoded protein (YPL283 and YGR296W code for identical proteins) 2.422 -0.295 1 w 255 ctgACGCGccata unknown similar to mouse REX1 encoded transcription factor G2/M 645 41 YPR013C YPR013C YPR013C YPD SGD MIPS 1.57 1.49 1.03 0.97 1.84 1.07 1.31 0.76 undocumented New Protein with similarity to mouse REX1 encoded transcription factor (SP:P22227) 1.421 1.984 unknown unknown G2/M 630 175 YPR014C YPR014C YPR014C YPD SGD MIPS 1.47 1.42 1.02 0.98 1.73 1.23 1.46 0.68 undocumented New Protein of unknown function 1.722 2.118 chromatin structure chromatin assembly factor I subunit G1 173 406 YPR018W RLF2 RLF2 YPD SGD MIPS 1.49 1.22 1.11 1.11 1.62 2.70 2.10 0.48 viable New "Aka CAC1; Chromatin Assembly Complex, subunit #1: Encodes the largest (p90) subunit of a three-subunit protein complex (yeast CAF-I) involved in DNA-replication-linked nucleosome assembly. Homologous to the p150 subunit of human Chromatin Assembly Factor-I (CAF-I)." 3.116 -0.864 1 w235 ctcACGCGTtcg 1 w235 ctcACGCGTtcg DNA replication MCM initiator complex G2/M 794 96 YPR019W CDC54 CDC54 YPD SGD MIPS 1.20 1.33 1.05 0.95 1.43 1.66 1.54 1.54 lethal New aka MCM4; MCM proteins are components of the prereplication complex because association of MCM proteins with replication origins requires both Orc1p and Cdc6 function 4.048 0.654 cytoskeleton (putative) actin-related protein S 468 668 YPR034W ARP7 ARP7 YPD SGD MIPS 1.11 1.40 1.25 1.25 1.50 1.03 1.21 0.83 undocumented New Protein with weak similarity to actin and actin-related protein Arp4p and Arp1p 1.417 -2.855 1 c 150 gaaACGCGgccat 1 c 150 gaaACGCGgccat 1 c 408 CTAACCAGCTCG unknown similar to C. elegans protein G2/M 609 167 YPR045C YPR045C YPR045C YPD SGD MIPS 1.31 1.08 1.10 1.10 2.88 1.08 1.76 0.57 undocumented New "Protein of unknown function, has similarity to C. elegans protein U13070 " 1.638 2.294 1 c 615 agaACGCGacgaa signaling (putative) pheromone pathway G1 398 748 YPR075C OPY2 OPY2 YPD SGD MIPS 1.89 1.24 1.53 1.53 2.35 1.01 1.54 0.65 undocumented New Protein that imparts Far- phenotype (GB:AF016263) 2.433 -2.184 2 w190 gaaACGCGTtaa w167 acaACGCGTtac 2 w190 gaaACGCGTtaa w167 acaACGCGTtac unknown unknown G1 385 749 YPR076W YPR076W YPR076W YPD SGD MIPS 1.07 1.40 1.22 1.22 1.71 1.27 1.47 0.68 undocumented New Protein of unknown function 2.115 -2.017 1 c 676 gatACGCGagagc 1 c 676 gatACGCGagagc 1 w 355 ATCACCAGCTGC staurosporine resistance protein kinase G1 387 398 YPR106W ISR1 ISR1 YPD SGD MIPS 1.07 1.27 1.17 1.17 1.49 1.01 1.23 0.81 undocumented New "Serine-threonine protein kinase, involved in staurosporine resistance " 5.016 -2.075 1 w 175 CAAACCAGCTAG mRNA 3'-end processing cleavage/polyadenylation specificity factor subunit S 440 363 YPR107C YTH1 YTH1 YPD SGD MIPS 1.41 1.08 1.23 0.81 1.96 1.23 1.26 0.79 lethal New Component of polyadenylation factor I 1.639 -2.565 1 w 202 tttACGCGccgtc 1 w 202 tttACGCGccgtc cell cycle M phase; protein kinase S/G2 604 660 YPR111W DBF20 DBF20 YPD SGD MIPS 1.52 1.16 1.33 0.75 2.40 1.39 1.31 0.76 viable New "Cell cycle protein kinase related to Dbf2p, involved in termination of M-phase " 2.573 2.309 cell cycle G2/M cyclin G2/M 661 239 YPR119W CLB2 CLB2 YPD SGD MIPS 1.54 1.43 1.49 0.67 3.95 3.23 3.57 3.57 viable Known B-type cyclin 10.050 1.897 2 TTGCACTTTCCTAAACGGGCTCAATATGTCAACAACGAAG ATATAGCGACCGAATCAGGAAAAG GTCAACAACGAAG 2 TTGCACTTTCCTAAACGGGCTCAATATGTCAACAACGAAG ATATAGCGACCGAATCAGGAAAAGGTCAACAACGAAG cell cycle G1/S cyclin G1 213 541 YPR120C CLB5 CLB5 YPD SGD MIPS 5.76 2.78 4.00 4.00 1.31 1.11 1.21 0.83 viable Known B-type cyclin involved in S-phase initiation 4.832 -1.104 2 w204 gctACGCGTcat w163 agtACGCGTggt 2 w204 gctACGCGTcat w163 agtACGCGTggt unknown similar to ADP/ATP carrier proteins G2/M 654 135 YPR128C YPR128C YPR128C YPD SGD MIPS 1.25 1.14 1.05 0.95 1.30 1.09 1.19 0.84 undocumented New Protein with similarity to ADP/ATP carrier proteins and members of the mitochondrial carrier family (MCF) 1.859 1.950 DNA replication polymerase alpha binding protein G1 223 558 YPR135W POB1 CTF4 YPD SGD MIPS 1.53 1.63 1.03 1.03 1.71 1.06 1.34 0.74 viable New "Protein required for DNA synthesis, binds polymerase alpha" 4.140 -1.155 3 w126 gcgACGCGTaat w 131 ttaACGCGACGCG c 396 ttaACGCGcttgt 1 w126 gcgACGCGTaat 2 w 131 ttaACGCGACGCG c 396 ttaACGCGcttgt transport ammonia permease G2/M 679 136 YPR138C MEP3 MEP3 YPD SGD MIPS 1.63 1.30 1.46 0.69 1.28 1.03 1.12 0.90 viable New Ammonia permease of high capacity and low affinity 1.589 1.762 1 c 466 CAAACCAGCTAC mating; nuclear fusion; mitosis kinesin-like protein G1 400 727 YPR141C KAR3 KAR3 YPD SGD MIPS 2.07 1.13 1.53 1.53 2.17 1.11 1.55 0.64 viable Known "Kinesin-like protein involved in mitosis and essential for the congression (nuclear migration) step of karyogamy, probable coiled-coil protein " 2.796 -2.220 2 c161 taaCGCGAAAaaa c 160 ttaACGCGaaaaa 1 c161 taaCGCGAAAaaa 1 c 160 ttaACGCGaaaaa 1 c 346 GAGGCCAGCAGA 1 c 346 GAGGCCAGCAGA "secretion, non-classical" unknown G2/M 684 203 YPR149W NCE102 NCE102 YPD SGD MIPS 3.76 2.94 3.33 0.30 1.30 4.33 2.37 2.37 undocumented New negative regulator of CTS1 expression 8.962 1.722 ATP synthesis regulates Atp6p and Atp8p synthesis S/G2 532 247 YPR155C NCA2 NCA2 YPD SGD MIPS 1.14 1.16 1.15 0.87 2.59 1.44 1.34 0.75 undocumented New Protein required for control of mitochondrial synthesis of Atp6p and Atp8p 1.347 3.038 unknown major facilitator superfamily G2/M 659 219 YPR156C YPR156C YPR156C YPD SGD MIPS 1.51 1.25 1.10 1.10 1.78 1.69 1.73 1.73 undocumented New "Member of major facilitator superfamily (MFS) multidrug-resistance proteins family 1, most similar to YGR138C" 7.421 1.919 1 c 103 gacCACGAAAttt unknown unknown G2/M 671 189 YPR157W YPR157W YPR157W YPD SGD MIPS 1.44 1.14 1.12 0.89 1.01 1.56 1.24 1.24 undocumented New Protein of unknown function 3.311 1.845 1 c 600 gctACGCGgattt cell wall biogenesis glucan synthase subunit S 442 776 YPR159W KRE6 KRE6 YPD SGD MIPS 2.66 1.22 1.80 1.80 3.09 1.26 1.57 0.64 viable Known "Glucan synthase subunit required for synthesis of beta-1,6-glucan " 2.139 -2.579 1 w 299 gagACGCGaatgc 1 w 299 gagACGCGaatgc glycogen metabolism glycogen phosphorylase G1 206 335 YPR160W GPH1 GPH1 YPD SGD MIPS 1.48 1.19 1.32 0.76 1.34 1.37 1.01 1.01 viable New "Glycogen phosphorylase, releases alpha-D-glucose-1-phosphate from glycogen " 1.539 -1.067 1 w 469 GCAGCCAGCACC 1 w 469 GCAGCCAGCACC sulfate assimilation 3'-phosphoadenylylsulfate reductase S/G2 531 649 YPR167C MET16 MET16 YPD SGD MIPS 2.73 1.07 1.71 1.71 1.44 1.15 1.29 0.78 undocumented New "3'-Phosphoadenylylsulfate reductase, part of the sulfate assimilation pathway " 1.788 3.047 1 w 38 AAGGCCAGCAAA 1 w 38 AAGGCCAGCAAA w 588 CCCAATGTAGAAAAGTACATCATATGAAACA unknown similar to C. elegans nuclear lamin G1 222 544 YPR174C YPR174C YPR174C YPD SGD MIPS 2.08 2.43 2.25 2.25 2.43 1.41 1.85 0.54 undocumented New Protein with weak similarity to C. elegans nuclear lamin and Nbp1 3.609 -1.147 3 w151 tcaCGCGAAAaat w140 ataACGCGTcac w 152 gtcACGCGaaaaa 1 w151 tcaCGCGAAAaat 1 w140 ataACGCGTcac 1 w 152 gtcACGCGaaaaa w 131 TTCAACGCGGGG DNA replication polymerase epsilon 80 kDa subunit G1 205 545 YPR175W DPB2 DPB2 YPD SGD MIPS 1.78 2.04 1.91 1.91 3.16 1.02 1.80 0.56 lethal Known DNA polymerase epsilon 80 kDa subunit 4.357 -1.066 5 c339 aaaCGCGAAAaat w375 caaACGCGTtta w295 gggACGCGTcga c 282 aagACGCGatttt c 338 caaACGCGaaaaa 1 c339 aaaCGCGAAAaat 2 w375 caaACGCGTtta w295 gggACGCGTcga 2 c 282 aagACGCGatttt c 338 caaACGCGaaaaa unknown similar to other subtelomerically-encoded proteins G1 154 580 YPR202W YPR202W YPR202W YPD SGD MIPS 1.76 2.69 2.17 2.17 1.58 1.19 1.15 0.87 undocumented New Protein with similarity to other subtelomerically-encoded proteins 3.287 -0.736 c 243 CCTTTTTCAGTTTCTATTTTTAACACTGAAACT unknown similar to other subtelomerically-encoded proteins G1 138 598 YPR203W YPR203W YPR203W YPD SGD MIPS 1.42 3.00 2.07 2.07 1.46 1.47 1.00 1.00 undocumented New Protein with similarity to other subtelomerically-encoded proteins 3.364 -0.647 1 w42 tgtCACGAAAtag 1 w42 tgtCACGAAAtag w 573 CAAAACCTGGGG unknown similar to other subtelomerically-encoded proteins M/G1 113 597 YPR204W YPR204W YPR204W YPD SGD MIPS 2.17 2.38 2.27 2.27 1.55 1.37 1.06 0.94 undocumented New Protein with similarity to other subtelomerically-encoded proteins 3.184 -0.526 1 w 125 taaCGCGAAAaag 1 w 126 gtaACGCGaaaaa G1 130 573 YEL077C YEL077C SGD MIPS 2.03 1.15 1.33 1.33 1.18 1.25 1.22 0.82 undocumented New "Protein with similarity to subtelomerically-encoded proteins including Yil177p, Yhl049p, and Yjl225p " 4.545 -0.599